Gene Page: GEMIN8

Summary
GeneID  54960
Symbol  GEMIN8
Synonyms  FAM51A1|FLJ20514|FLJ43072
Description  gem (nuclear organelle) associated protein 8
See related  HGNC:26044|Ensembl:ENSG00000046647|HPRD:06533|
Locus tag  -
Gene type  protein-coding
Map location  Xp22.2
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI17023415 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000387spliceosomal snRNP biogenesisIDA16434402 
GO:0006397mRNA processingIEA-
GO:0008380RNA splicingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA16434402 
GO:0005681spliceosomeIEA-
GO:0005737cytoplasmIDA17023415 
GO:0032797SMN complexIDAneuron (GO term level: 6)16434402 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-182192198m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-34b301307m8hsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.