Gene Page: CAMK2N1

Summary
GeneID  55450
Symbol  CAMK2N1
Synonyms  MGC22256|PRO1489|RP11-401M16.1
Description  calcium/calmodulin-dependent protein kinase II inhibitor 1
See related  HGNC:24190|Ensembl:ENSG00000162545|HPRD:13112|
Locus tag  -
Gene type  protein-coding
Map location  1p36.12
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 5 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004860protein kinase inhibitor activityIEA-
GO:0008427calcium-dependent protein kinase inhibitor activityISS-
GO:0019901protein kinase bindingISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneIEA-
GO:0014069postsynaptic densityIEASynap (GO term level: 10)-
GO:0019717synaptosomeIEASynap, Brain (GO term level: 7)-
GO:0030054cell junctionIEA-
GO:0030425dendriteISSneuron, axon, dendrite (GO term level: 6)-
GO:0043025cell somaISSaxon, dendrite (GO term level: 4)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GRIN2BMGC142178 | MGC142180 | NMDAR2B | NR2B | hNR3glutamate receptor, ionotropic, N-methyl D-aspartate 2B-HPRD12650977 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-129-5p10741080m8hsa-miR-129brainCUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5pCUUUUUGCGGUCUGGGCUUGCU
miR-138120212081Ahsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-17-5p/20/93.mr/106/519.d7985m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-1811931199m8hsa-miR-18aUAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18bUAAGGUGCAUCUAGUGCAGUUA
miR-1829299351Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-222953011Ahsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-30-5p4434501A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-450107410801Ahsa-miR-450UUUUUGCGAUGUGUUCCUAAUA
miR-493-5p122712341A,m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-53912181224m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-96121Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-93.hd/291-3p/294/295/302/372/373/5207884m8hsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
miR-969289351A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.