Gene Page: CCDC88A

Summary
GeneID  55704
Symbol  CCDC88A
Synonyms  APE|DKFZp686D0630|GIRDIN|GIV|GRDN|HkRP1|KIAA1212
Description  coiled-coil domain containing 88A
See related  HGNC:25523|MIM:609736|Ensembl:ENSG00000115355|HPRD:10051|HPRD:11131|
Locus tag  -
Gene type  protein-coding
Map location  2p16.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1667 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003779actin bindingIDA16139227 
GO:0008017microtubule bindingISS-
GO:0035091phosphoinositide bindingIDA16139227 
GO:0042803protein homodimerization activityIPI16139227 
GO:0043422protein kinase B bindingIPI16139227 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001932regulation of protein amino acid phosphorylationISS-
GO:0006275regulation of DNA replicationISS-
GO:0016044membrane organizationIDA15882442 
GO:0016477cell migrationIMP16139227 
GO:0030032lamellipodium biogenesisIMP16139227 
GO:0032148activation of protein kinase B activityISS-
GO:0032956regulation of actin cytoskeleton organizationIMP16139227 
GO:0042127regulation of cell proliferationISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005783endoplasmic reticulumIDA15882442 
GO:0005794Golgi apparatusIDA15882442 
GO:0005829cytosolIDA15749703 
GO:0005886plasma membraneIDA15882442 
GO:0030027lamellipodiumIDA16139227 
GO:0031410cytoplasmic vesicleIDA15882442 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-101273627421Ahsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-12826462652m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-129-5p108110871Ahsa-miR-129brainCUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5pCUUUUUGCGGUCUGGGCUUGCU
miR-130/30129862992m8hsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-144273527421A,m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-1826052611m8hsa-miR-18aUAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18bUAAGGUGCAUCUAGUGCAGUUA
miR-1814794851Ahsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-1822192251Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-19192419311A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-203.131233129m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-218107610831A,m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-378271827251A,m8hsa-miR-378CUCCUGACUCCAGGUCCUGUGU
miR-43188941Ahsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-488274727531Ahsa-miR-488CCCAGAUAAUGGCACUCUCAA
miR-495105110571Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-53955611Ahsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
miR-93.hd/291-3p/294/295/302/372/373/520298829941Ahsa-miR-93brainAAAGUGCUGUUCGUGCAGGUAG
hsa-miR-302aUAAGUGCUUCCAUGUUUUGGUGA
hsa-miR-302bUAAGUGCUUCCAUGUUUUAGUAG
hsa-miR-302cUAAGUGCUUCCAUGUUUCAGUGG
hsa-miR-302dUAAGUGCUUCCAUGUUUGAGUGU
hsa-miR-372AAAGUGCUGCGACAUUUGAGCGU
hsa-miR-373GAAGUGCUUCGAUUUUGGGGUGU
hsa-miR-520eAAAGUGCUUCCUUUUUGAGGG
hsa-miR-520aAAAGUGCUUCCCUUUGGACUGU
hsa-miR-520bAAAGUGCUUCCUUUUAGAGGG
hsa-miR-520cAAAGUGCUUCCUUUUAGAGGGUU
hsa-miR-520dAAAGUGCUUCUCUUUGGUGGGUU
miR-962192251Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.