Gene Page: MASP1

Summary
GeneID  5648
Symbol  MASP1
Synonyms  CRARF|CRARF1|DKFZp686I01199|FLJ26383|MASP|MGC126283|MGC126284|PRSS5|RaRF
Description  mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
See related  HGNC:6901|MIM:600521|Ensembl:ENSG00000127241|HPRD:02749|
Locus tag  -
Gene type  protein-coding
Map location  3q27-q28
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003824catalytic activityIEA-
GO:0004252serine-type endopeptidase activityIEAglutamate (GO term level: 7)-
GO:0004252serine-type endopeptidase activityTASglutamate (GO term level: 7)8018603 
GO:0005509calcium ion bindingIEA-
GO:0005529sugar bindingIEA-
GO:0008233peptidase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001867complement activation, lectin pathwayEXP11532276 
GO:0006508proteolysisIEA-
GO:0006958complement activation, classical pathwayIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionEXP10639434 |10925294 
GO:0043231intracellular membrane-bounded organelleIDA18029348 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
C2CO2 | DKFZp779M0311complement component 2-HPRD10946292 
C3ARMD9 | ASP | CPAMD1complement component 3-HPRD9719152 
FCN2EBP-37 | FCNL | P35 | ficolin-2ficolin (collagen/fibrinogen domain containing lectin) 2 (hucolin)-HPRD,BioGRID12421953 
MASP2MAP19 | MASP-2 | sMAPmannan-binding lectin serine peptidase 2Affinity Capture-WesternBioGRID10878362 
MBL2COLEC1 | HSMBPC | MBL | MBP | MBP1 | MGC116832 | MGC116833mannose-binding lectin (protein C) 2, soluble (opsonic defect)-HPRD,BioGRID10878362 
SERPING1C1IN | C1INH | C1NH | HAE1 | HAE2serpin peptidase inhibitor, clade G (C1 inhibitor), member 1-HPRD,BioGRID10946292 
 
KEGG Pathway Info
hsa04610: Complement and coagulation cascades - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98304310m8hsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-125/351150115081A,m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.