Gene Page: PTPRA

Summary
GeneID  5786
Symbol  PTPRA
Synonyms  HEPTP|HLPR|HPTPA|HPTPalpha|LRP|PTPA|PTPRL2|R-PTP-alpha|RPTPA
Description  protein tyrosine phosphatase, receptor type, A
See related  HGNC:9664|MIM:176884|Ensembl:ENSG00000132670|HPRD:01476|
Locus tag  RP4-534B8.1
Gene type  protein-coding
Map location  20p13
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0261 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0005001transmembrane receptor protein tyrosine phosphatase activityTAS2169617 
GO:0016787hydrolase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIEA-
GO:0006470protein amino acid dephosphorylationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005887integral to plasma membraneTAS2169617 
GO:0016020membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
FYNMGC45350 | SLK | SYNFYN oncogene related to SRC, FGR, YES-HPRD,BioGRID9535845 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2An unspecified isoform of GRB2 interacts with PTPRA.BIND8670803 
-HPRD,BioGRID7518772 |8670803 
|11923305 
KCNA2HBK5 | HK4 | HUKIV | KV1.2 | MGC50217 | MK2 | NGK1 | RBK2potassium voltage-gated channel, shaker-related subfamily, member 2Affinity Capture-Western
Reconstituted Complex
BioGRID9878055 
PTPRAHEPTP | HLPR | HPTPA | HPTPalpha | LRP | PTPA | PTPRL2 | R-PTP-alpha | RPTPAprotein tyrosine phosphatase, receptor type, ARPTP-alpha forms a homodimer.BIND11401727 
PTPRDHPTP | HPTP-DELTA | HPTPD | MGC119750 | MGC119751 | MGC119752 | MGC119753 | PTPD | R-PTP-DELTAprotein tyrosine phosphatase, receptor type, D-HPRD10777529 
PTPRFFLJ43335 | FLJ45062 | FLJ45567 | LARprotein tyrosine phosphatase, receptor type, F-HPRD10777529 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)Affinity Capture-WesternBioGRID11923305 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2063113171Ahsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-1463523591A,m8hsa-miR-146aUGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrainUGAGAACUGAAUUCCAUAGGCU
miR-2183443511A,m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-49559651Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-4961511571Ahsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.