Gene Page: RALB

Summary
GeneID  5899
Symbol  RALB
Synonyms  -
Description  v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
See related  HGNC:9840|MIM:179551|Ensembl:ENSG00000144118|HPRD:01550|
Locus tag  -
Gene type  protein-coding
Map location  2cen-q13
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.023 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00755 
ExpressionExpressionP value: 1.457 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005515protein bindingIPI7673236 
GO:0005525GTP bindingIEA-
GO:0005525GTP bindingTAS2120779 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007264small GTPase mediated signal transductionIEA-
GO:0007265Ras protein signal transductionEXP11520933 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005886plasma membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EXOC2FLJ11026 | SEC5 | SEC5L1 | Sec5pexocyst complex component 2Two-hybridBioGRID14525976 
EXOC8EXO84 | Exo84p | SEC84exocyst complex component 8Affinity Capture-Western
Two-hybrid
BioGRID14525976 
RALBP1RIP1 | RLIP1 | RLIP76ralA binding protein 1-HPRD,BioGRID7673236 
RalB interacts with RLIP76.BIND7673236 
REPS2POB1RALBP1 associated Eps domain containing 2-HPRD9422736 
RGL4MGC119678 | MGC119680 | Rgrral guanine nucleotide dissociation stimulator-like 4-HPRD,BioGRID12874025 
 
KEGG Pathway Info
hsa05212: Pancreatic cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.1128012871A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-9140314091Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.