|
|
|
GeneID
|
5899
|
|
Symbol
|
RALB |
|
Synonyms
|
- |
|
Description
|
v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein) |
|
See related
|
HGNC:9840|MIM:179551|Ensembl:ENSG00000144118|HPRD:01550| |
|
Locus tag
|
- |
|
Gene type
|
protein-coding |
|
Map location
|
2cen-q13 |
|
|
| |
|
|
| Gene set name | Method of gene set | Evidence | Info |
| GSMA_I | genome scan meta-analysis | Psr: 0.023 | | | GSMA_IIA | genome scan meta-analysis (All samples) | Psr: 0.00755 | | | Expression | Expression | P value: 1.457 | |
|
| |
|
 |
| |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0000166 | nucleotide binding | IEA | | - |
| GO:0005515 | protein binding | IPI | | 7673236 |
| GO:0005525 | GTP binding | IEA | | - |
| GO:0005525 | GTP binding | TAS | | 2120779 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0007264 | small GTPase mediated signal transduction | IEA | | - |
| GO:0007265 | Ras protein signal transduction | EXP | | 11520933 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005622 | intracellular | IEA | | - |
| GO:0005886 | plasma membrane | IEA | | - |
| |
|
|
| |
|
|
| |
|
| miR-203.1 | 1280 | 1287 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG | | miR-9 | 1403 | 1409 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|