Gene Page: BCL2

Summary
GeneID  596
Symbol  BCL2
Synonyms  Bcl-2
Description  B-cell CLL/lymphoma 2
See related  HGNC:990|MIM:151430|Ensembl:ENSG00000171791|HPRD:01045|
Locus tag  -
Gene type  protein-coding
Map location  18q21.33|18q21.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1729 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0002020protease bindingIDA10620603 
GO:0042803protein homodimerization activityIDA9111042 
GO:0046982protein heterodimerization activityIPI9111042 
GO:0051434BH3 domain bindingIPI9111042 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001836release of cytochrome c from mitochondriaNAS9027314 
GO:0006916anti-apoptosisIDA9027314 |10506221 |10620603 
|11684014 
GO:0006959humoral immune responseTAS1908951 
GO:0007565female pregnancyNAS11530860 
GO:0008219cell deathIDA8949945 
GO:0008284positive regulation of cell proliferationIEA-
GO:0008633activation of pro-apoptotic gene productsEXP15231831 
GO:0009314response to radiationNAS15799693 
GO:0009636response to toxinIDA16307838 
GO:0010039response to iron ionIDA11264898 
GO:0031069hair follicle morphogenesisIEA-
GO:0032848negative regulation of cellular pH reductionIDA10506221 
GO:0034097response to cytokine stimulusIDA9184696 
GO:0035094response to nicotineIDA12421819 
GO:0042100B cell proliferationIDA1373874 
GO:0042493response to drugIDA8949945 
GO:0043473pigmentationIEA-
GO:0043496regulation of protein homodimerization activityIDA9111042 
GO:0043497regulation of protein heterodimerization activityIDA9111042 
GO:0043524negative regulation of neuron apoptosisIEAneuron (GO term level: 9)-
GO:0045069regulation of viral genome replicationIEA-
GO:0046902regulation of mitochondrial membrane permeabilityISS9843949 
GO:0051607defense response to virusIDA10620603 
GO:0051881regulation of mitochondrial membrane potentialISS9843949 
GO:0051902negative regulation of mitochondrial depolarizationTAS9027314 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIDA11530860 
GO:0005739mitochondrionIDA9027314 
GO:0005741mitochondrial outer membraneEXP10198631 |11463392 |12624108 
GO:0005741mitochondrial outer membraneIDA9027314 
GO:0005741mitochondrial outer membraneTAS1453000 
GO:0005783endoplasmic reticulumIEA-
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005829cytosolIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0031965nuclear membraneIDA1502141 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ATP2A2ATP2B | DAR | DD | DKFZp686P0211 | FLJ20293 | FLJ38063 | MGC45367 | SERCA2ATPase, Ca++ transporting, cardiac muscle, slow twitch 2-HPRD9788433 
AVENPDCD12apoptosis, caspase activation inhibitorAffinity Capture-Western
Two-hybrid		BioGRID10949025 
BADBBC2 | BCL2L8BCL2-associated agonist of cell deathBcl-2 interacts with Bad.BIND9130713 
-HPRD,BioGRID7834748 
Bad interacts with Bcl-2.BIND15694340 
Bad interacts with Bcl-2.BIND15574335 
BAG1RAP46BCL2-associated athanogene-HPRD,BioGRID9305631 
BAG3BAG-3 | BIS | CAIR-1 | MGC104307BCL2-associated athanogene 3Bcl-2 interacts with BAG-3. This interaction was modelled on a demonstrated interaction between Bcl-2 from an unspecified species and human BAG-3.BIND11527400 
-HPRD11513873 
BAG4BAG-4 | SODDBCL2-associated athanogene 4-HPRD,BioGRID11527400 
Bcl-2 interacts with BAG-4. This interaction was modelled on a demonstrated interaction between Bcl-2 from an unspecified species and human BAG-4.BIND11527400 
BAK1BAK | BAK-LIKE | BCL2L7 | CDN1 | MGC117255 | MGC3887BCL2-antagonist/killer 1-HPRD,BioGRID11728179 
BAXBCL2L4BCL2-associated X protein-HPRD,BioGRID8358790 
Bax interacts with Bcl-2.BIND15574335 
-HPRD8358790|9111042 
Bcl-2 interacts with Bax.BIND9130713 
BBC3JFY1 | PUMABCL2 binding component 3PUMA-beta interacts with Bcl-2.BIND11463392 
-HPRD,BioGRID11463392 
PUMA interacts with Bcl-2.BIND15574335 
PUMA-alpha interacts with Bcl-2.BIND11463392 
Puma interacts with Bcl-2.BIND15694340 
BCAP316C6-AG | BAP31 | CDM | DXS1357EB-cell receptor-associated protein 31-HPRD,BioGRID9334338 
BCL2Bcl-2B-cell CLL/lymphoma 2-HPRD9111042 |15302859 
BCL2L1BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xSBCL2-like 1-HPRD11583631 
Affinity Capture-Western
Protein-peptide		BioGRID12137781 |14980220 
BCL2L10BCL-B | Boo | Diva | MGC129810 | MGC129811BCL2-like 10 (apoptosis facilitator)-HPRD,BioGRID11278245 
BCL2L11BAM | BIM | BIM-alpha6 | BIM-beta6 | BIM-beta7 | BOD | BimEL | BimLBCL2-like 11 (apoptosis facilitator)-HPRD,BioGRID9430630 
Bim interacts with Bcl-2.BIND15694340 
BCL2L14BCLGBCL2-like 14 (apoptosis facilitator)-HPRD11054413 
BCLAF1BTF | KIAA0164 | bK211L9.1BCL2-associated transcription factor 1-HPRD10330179 
BECN1ATG6 | VPS30 | beclin1beclin 1, autophagy related-HPRD,BioGRID9765397 
BFARBAR | RNF47bifunctional apoptosis regulator-HPRD10716992 
BIDFP497 | MGC15319 | MGC42355BH3 interacting domain death agonistBid interacts with Bcl-2.BIND15694340 
Protein-peptideBioGRID15520201 |15694340 
Bid interacts with Bcl-2.BIND15574335 
-HPRD9727491 
BIKBIP1 | BP4 | NBKBCL2-interacting killer (apoptosis-inducing)-HPRD9525867 |12853473|12853473 
Bcl-2 interacts with Bik.BIND9130713 
Bik interacts with Bcl-2.BIND15694340 
-HPRD,BioGRID12853473 
BLKMGC10442B lymphoid tyrosine kinase-HPRD,BioGRID9525867 
BMFFLJ00065Bcl2 modifying factorBmf interacts with Bcl-2. This interaction was modelled on a demonstrated interaction between mouse Bmf and human Bcl-2.BIND15694340 
-HPRD,BioGRID11546872 
BNIP1NIP1 | SEC20 | TRG-8BCL2/adenovirus E1B 19kDa interacting protein 1-HPRD,BioGRID10217402 
BNIP2BNIP-2 | NIP2BCL2/adenovirus E1B 19kDa interacting protein 2-HPRD,BioGRID7954800 |12901880 
BNIP3NIP3BCL2/adenovirus E1B 19kDa interacting protein 3-HPRD,BioGRID10625696 
BNIP3LBNIP3a | NIXBCL2/adenovirus E1B 19kDa interacting protein 3-like-HPRD,BioGRID9973195|10467396 
BNIPLBNIP-S | BNIPL-1 | BNIPL-2 | BNIPL1 | BNIPL2 | PP753BCL2/adenovirus E1B 19kD interacting protein like-HPRD,BioGRID12901880 
BNIPL-2 interacts with Bcl-2.BIND12901880 
CAPN2CANP2 | CANPL2 | CANPml | FLJ39928 | mCANPcalpain 2, (m/II) large subunitBiochemical Activity
Reconstituted Complex		BioGRID12000759 
CASP2CASP-2 | ICH-1L | ICH-1L/1S | ICH1 | NEDD2caspase 2, apoptosis-related cysteine peptidasePhenotypic SuppressionBioGRID11832478 
CASP3CPP32 | CPP32B | SCA-1caspase 3, apoptosis-related cysteine peptidase-HPRD,BioGRID11948397 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidase-HPRD,BioGRID11406564 
CDC2CDC28A | CDK1 | DKFZp686L20222 | MGC111195cell division cycle 2, G1 to S and G2 to MAffinity Capture-WesternBioGRID11326318 |11774038 
CDK2p33(CDK2)cyclin-dependent kinase 2-HPRD15619620 
CYCSCYC | HCScytochrome c, somatic-HPRD10622714 
DYNLL1DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1dynein, light chain, LC8-type 1Affinity Capture-WesternBioGRID10198631 
EPHB2CAPB | DRT | EPHT3 | ERK | Hek5 | MGC87492 | PCBC | Tyro5EPH receptor B2Biochemical ActivityBioGRID15225643 
FKBP8FKBP38 | FKBPr38FK506 binding protein 8, 38kDa-HPRD,BioGRID12510191 
HRASC-BAS/HAS | C-H-RAS | C-HA-RAS1 | CTLO | H-RASIDX | HAMSV | HRAS1 | K-RAS | N-RAS | RASH1v-Ha-ras Harvey rat sarcoma viral oncogene homolog-HPRD10490827 
HRKDP5 | HARAKIRIharakiri, BCL2 interacting protein (contains only BH3 domain)-HPRD,BioGRID9130713 |10075695 
Hrk interacts with Bcl-2.BIND9130713 
Hrk interacts with Bcl-2.BIND15694340 
HSPA1AFLJ54303 | FLJ54370 | FLJ54392 | FLJ54408 | FLJ75127 | HSP70-1 | HSP70-1A | HSP70I | HSP72 | HSPA1 | HSPA1Bheat shock 70kDa protein 1A-HPRD,BioGRID10354271 
IRS1HIRS-1insulin receptor substrate 1Affinity Capture-WesternBioGRID10679027 
IRS2-insulin receptor substrate 2Affinity Capture-WesternBioGRID10679027 
ITM2BABRI | BRI | BRI2 | BRICD2B | E25B | E3-16 | FBDintegral membrane protein 2B-HPRD,BioGRID12082633 
ITPR1INSP3R1 | IP3R | IP3R1 | SCA15 | SCA16inositol 1,4,5-triphosphate receptor, type 1Affinity Capture-WesternBioGRID15613488 
KRASC-K-RAS | K-RAS2A | K-RAS2B | K-RAS4A | K-RAS4B | KI-RAS | KRAS1 | KRAS2 | NS3 | RASK2v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog-HPRD10490827 
MAPK1ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapkmitogen-activated protein kinase 1-HPRD15225643 
MAPK11P38B | P38BETA2 | PRKM11 | SAPK2 | SAPK2B | p38-2 | p38Betamitogen-activated protein kinase 11-HPRD11495898 
MOAP1MAP-1 | PNMA4modulator of apoptosis 1-HPRD,BioGRID11060313 
MAP-1 interacts with Bcl-2.BIND11060313 
MYCbHLHe39 | c-Mycv-myc myelocytomatosis viral oncogene homolog (avian)Affinity Capture-Western
Co-localization		BioGRID15210690 
NR4A1GFRP1 | HMR | MGC9485 | N10 | NAK-1 | NGFIB | NP10 | NUR77 | TR3nuclear receptor subfamily 4, group A, member 1-HPRD,BioGRID14980220 
NRASALPS4 | N-ras | NRAS1neuroblastoma RAS viral (v-ras) oncogene homolog-HPRD10490827 
P53AIP1-p53-regulated apoptosis-inducing protein 1-HPRD,BioGRID12019168 
PARP1ADPRT | ADPRT1 | PARP | PARP-1 | PPOL | pADPRT-1poly (ADP-ribose) polymerase 1-HPRD,BioGRID11790116 
PIN1DOD | UBL5peptidylprolyl cis/trans isomerase, NIMA-interacting 1-HPRD11988841 
Affinity Capture-WesternBioGRID11326318 
PKMYT1DKFZp547K1610 | FLJ20093 | MYT1protein kinase, membrane associated tyrosine/threonine 1-HPRD11326318 
PMAIP1APR | NOXAphorbol-12-myristate-13-acetate-induced protein 1-HPRD,BioGRID10807576 
PPP1CAMGC15877 | MGC1674 | PP-1A | PPP1Aprotein phosphatase 1, catalytic subunit, alpha isoform-HPRD11390485 
PPP2CAPP2Ac | PP2CA | RP-Cprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform-HPRD,BioGRID9852076 
PPP2R4MGC2184 | PP2A | PR53 | PTPAprotein phosphatase 2A activator, regulatory subunit 4Biochemical ActivityBioGRID15225643 
PPP2R5AB56A | MGC131915 | PR61Aprotein phosphatase 2, regulatory subunit B', alpha isoform-HPRD,BioGRID11929874 
PPP3CACALN | CALNA | CALNA1 | CCN1 | CNA1 | PPP2Bprotein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform-HPRD,BioGRID7593193 |9109491 
PSEN1AD3 | FAD | PS1 | S182presenilin 1-HPRD,BioGRID10521466 
RAD9ARAD9RAD9 homolog A (S. pombe)-HPRD,BioGRID10620799 
RAF1CRAF | NS5 | Raf-1 | c-Rafv-raf-1 murine leukemia viral oncogene homolog 1-HPRD,BioGRID8910675 |8929532 
RHEBMGC111559 | RHEB2Ras homolog enriched in brainBcl-2 interacts with Rheb.BIND9130713 
RRAS-related RAS viral (r-ras) oncogene homolog-HPRD,BioGRID8232588 
RTN4ASY | NI220/250 | NOGO | NOGO-A | NOGOC | NSP | NSP-CL | Nbla00271 | Nbla10545 | Nogo-B | Nogo-C | RTN-X | RTN4-A | RTN4-B1 | RTN4-B2 | RTN4-Creticulon 4RTN-XS interacts with Bcl-2.BIND11126360 
-HPRD,BioGRID11126360 
SERPINB8CAP2 | PI8serpin peptidase inhibitor, clade B (ovalbumin), member 8Affinity Capture-WesternBioGRID15231068 
SF1D11S636 | ZFM1 | ZNF162splicing factor 1-HPRD,BioGRID8668206 
SMN1BCD541 | SMA | SMA1 | SMA2 | SMA3 | SMA4 | SMA@ | SMN | SMNT | T-BCD541survival of motor neuron 1, telomeric-HPRD,BioGRID9389483 
SOD1ALS | ALS1 | IPOA | SOD | homodimersuperoxide dismutase 1, soluble-HPRD,BioGRID15233914 
SPNS1FLJ38358 | HSpin1 | LAT | PP2030 | SPIN1 | SPINL | nrsspinster homolog 1 (Drosophila)-HPRD,BioGRID12815463 
TMBIM6BAXI1 | BI-1 | TEGTtransmembrane BAX inhibitor motif containing 6-HPRD,BioGRID9660918 
TOMM20KIAA0016 | MAS20 | MGC117367 | MOM19 | TOM20translocase of outer mitochondrial membrane 20 homolog (yeast)-HPRD,BioGRID9119086 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD12667443 
TP53BP253BP2 | ASPP2 | BBP | PPP1R13A | p53BP2tumor protein p53 binding protein, 2-HPRD,BioGRID8668206 
 
KEGG Pathway Info
hsa04210: Apoptosis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04510: Focal adhesion - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05014: Amyotrophic lateral sclerosis (ALS) - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05060: Prion disease - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05210: Colorectal cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05215: Prostate cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05222: Small cell lung cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-143181918251Ahsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-149239824041Ahsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-15/16/195/424/497252925361A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-15326321Ahsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-181175217581Ahsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-1822052111Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-204/2112092161A,m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-20539203926m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-217207261Ahsa-miR-21brainUAGCUUAUCAGACUGAUGUUGA
hsa-miR-590GAGCUUAUUCAUAAAAGUGCAG
miR-217256825741Ahsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-30-5p248724931Ahsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-34/4492032091Ahsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-365171117171Ahsa-miR-365UAAUGCCCCUAAAAAUCCUUAU
miR-3847047101Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-4485864m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-493-5p37463752m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-503253025361Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
miR-962052111Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.