Gene Page: SORT1

Summary
GeneID  6272
Symbol  SORT1
Synonyms  Gp95|NT3
Description  sortilin 1
See related  HGNC:11186|MIM:602458|Ensembl:ENSG00000134243|HPRD:03910|
Locus tag  -
Gene type  protein-coding
Map location  1p21.3-p13.1|1p21.3-p13.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0005344oxygen transporter activityIEA-
GO:0010465nerve growth factor receptor activityIDAneuron (GO term level: 7)14985763 
GO:0019899enzyme bindingIPI10085125 
GO:0030379neurotensin receptor activity, non-G-protein coupledIDA9756851 
GO:0048406nerve growth factor bindingIPI14985763 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001503ossificationIEA-
GO:0006810transportIEA-
GO:0006895Golgi to endosome transportIDA11331584 
GO:0006897endocytosisIEA-
GO:0007218neuropeptide signaling pathwayIDANeurotransmitter (GO term level: 8)9756851 
GO:0007275multicellular organismal developmentIEA-
GO:0008333endosome to lysosome transportIDA11331584 
GO:0008624induction of apoptosis by extracellular signalsIMP14985763 
GO:0010468regulation of gene expressionIMP18258592 
GO:0014902myotube differentiationIMP18258592 
GO:0016050vesicle organizationIDA15992544 
GO:0030154cell differentiationIEA-
GO:0032509endosome transport via multivesicular body sorting pathwayIDA11331584 
GO:0032868response to insulin stimulusIMP15992544 
GO:0043066negative regulation of apoptosisIDA14985763 
GO:0046323glucose importIMP15992544 
GO:0048011nerve growth factor receptor signaling pathwayIMP14985763 
GO:0048227plasma membrane to endosome transportIDA11331584 
GO:0051005negative regulation of lipoprotein lipase activityIDA10085125 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005765lysosomal membraneIEA-
GO:0005769early endosomeIDA11331584 
GO:0005783endoplasmic reticulumIEA-
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005792microsomeIDA15992544 
GO:0005794Golgi apparatusIEA-
GO:0005886plasma membraneIEA-
GO:0005905coated pitIDA11331584 
GO:0009986cell surfaceIDA10085125 
GO:0010008endosome membraneIEA-
GO:0016021integral to membraneIEA-
GO:0016023cytoplasmic membrane-bounded vesicleIDA9756851 
GO:0030140trans-Golgi network transport vesicleIEA-
GO:0031965nuclear membraneIEA-
GO:0048471perinuclear region of cytoplasmIDA11331584 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CDK2p33(CDK2)cyclin-dependent kinase 2Affinity Capture-MSBioGRID17353931 
GGA1-golgi associated, gamma adaptin ear containing, ARF binding protein 1-HPRD11390366 
GGA2FLJ20966 | KIAA1080 | VEARgolgi associated, gamma adaptin ear containing, ARF binding protein 2-HPRD11331584 |11390366 
-HPRD,BioGRID11331584 
LRPAP1A2MRAP | A2RAP | HBP44 | MGC138272 | MRAP | RAPlow density lipoprotein receptor-related protein associated protein 1Reconstituted ComplexBioGRID9013611 
NGFBeta-NGF | HSAN5 | MGC161426 | MGC161428 | NGFBnerve growth factor (beta polypeptide)-HPRD,BioGRID14985763 
NGFRCD271 | Gp80-LNGFR | TNFRSF16 | p75(NTR) | p75NTRnerve growth factor receptor (TNFR superfamily, member 16)p75NTR interacts with sortilin. This interaction was modeled on a demonstrated interaction between p75NTR from human and sortilin from an unspecified species.BIND14985763 
NTSNMN-125 | NN | NT | NT/N | NTS1neurotensinin vivoBioGRID9756851 
SLC2A4GLUT4solute carrier family 2 (facilitated glucose transporter), member 4Glut4 interacts with Sortilin. This interaction was modeled on a demonstrated interaction between human Glut4 and mouse Sortilin.BIND15992544 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/35140804086m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-142-5p385338591Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-146394439511A,m8hsa-miR-146aUGAGAACUGAAUUCCAUGGGUU
hsa-miR-146bbrainUGAGAACUGAAUUCCAUAGGCU
miR-182153815441Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-24*6246301Ahsa-miR-189GUGCCUACUGAGCUGAUAUCAGU
miR-410385538611Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-50440824088m8hsa-miR-504AGACCCUGGUCUGCACUCUAU
miR-935343540m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
miR-96153715441A,m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.