Gene Page: SATB1

Summary
GeneID  6304
Symbol  SATB1
Synonyms  -
Description  SATB homeobox 1
See related  HGNC:10541|MIM:602075|Ensembl:ENSG00000182568|HPRD:03647|
Locus tag  -
Gene type  protein-coding
Map location  3p23
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.006 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003690double-stranded DNA bindingTAS1505028 
GO:0003700transcription factor activityIEA-
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000122negative regulation of transcription from RNA polymerase II promoterIMP15851481 
GO:0006325establishment or maintenance of chromatin architectureIEA-
GO:0006325establishment or maintenance of chromatin architectureTAS1505028 
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0016571histone methylationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005634nucleusTAS1505028 
GO:0005720nuclear heterochromatinIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BAZ1AACF1 | DKFZp586E0518 | FLJ14383 | WALp1 | WCRF180 | hACF1bromodomain adjacent to zinc finger domain, 1ACo-fractionation
Reconstituted Complex
BioGRID12374985 
CHD3Mi-2a | Mi2-ALPHA | ZFHchromodomain helicase DNA binding protein 3-HPRD12374985 
CHD4DKFZp686E06161 | Mi-2b | Mi2-BETAchromodomain helicase DNA binding protein 4Affinity Capture-Western
Co-fractionation
BioGRID12374985 
CUX1CASP | CDP | CDP/Cut | CDP1 | COY1 | CUTL1 | CUX | Clox | Cux/CDP | GOLIM6 | Nbla10317 | p100 | p110 | p200 | p75cut-like homeobox 1-HPRD,BioGRID10373541 
HDAC1DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1histone deacetylase 1-HPRD,BioGRID12374985 
HDAC2RPD3 | YAF1histone deacetylase 2Co-fractionationBioGRID12374985 
MTA2DKFZp686F2281 | MTA1L1 | PIDmetastasis associated 1 family, member 2-HPRD,BioGRID12374985 
POLR2JMGC71910 | POLR2J1 | RPB11 | RPB11A | RPB11m | hRPB14polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDaReconstituted Complex
Two-hybrid
BioGRID12036295 
SATB1-SATB homeobox 1-HPRD12374985 
SIN3ADKFZp434K2235 | FLJ90319 | KIAA0700SIN3 homolog A, transcription regulator (yeast)Co-fractionationBioGRID12374985 
SMARCA5ISWI | SNF2H | WCRF135 | hISWI | hSNF2HSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5-HPRD,BioGRID12374985 
UBE2IC358B7.1 | P18 | UBC9ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-137873879m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-1539099151Ahsa-miR-153UUGCAUAGUCACAAAAGUGA
hsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-155334340m8hsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
miR-189629681Ahsa-miR-18aUAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18bUAAGGUGCAUCUAGUGCAGUUA
miR-186115511611Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-191231291Ahsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-194111811241Ahsa-miR-194UGUAACAGCAACUCCAUGUGGA
miR-2088048101Ahsa-miR-208AUAAGACGAGCAAAAAGCUUGU
miR-21933939m8hsa-miR-21brainUAGCUUAUCAGACUGAUGUUGA
hsa-miR-590GAGCUUAUUCAUAAAAGUGCAG
miR-219102810341Ahsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-236406471A,m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-30-5p102410301Ahsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-3236406461Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
hsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-34/449539545m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-376110011061Ahsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
miR-376c861867m8hsa-miR-376cAACAUAGAGGAAAUUCCACG
miR-381525531m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-4489759811Ahsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
miR-485-5p3233291Ahsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
miR-495111611221Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-4998048101Ahsa-miR-499UUAAGACUUGCAGUGAUGUUUAA
miR-544116211691A,m8hsa-miR-544AUUCUGCAUUUUUAGCAAGU
miR-710131019m8hsa-miR-7SZUGGAAGACUAGUGAUUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.