Gene Page: SLC7A2

Summary
GeneID  6542
Symbol  SLC7A2
Synonyms  ATRC2|CAT-2|HCAT2
Description  solute carrier family 7 (cationic amino acid transporter, y+ system), member 2
See related  HGNC:11060|MIM:601872|Ensembl:ENSG00000003989|HPRD:03524|
Locus tag  -
Gene type  protein-coding
Map location  8p22-p21.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.031 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.00057 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.03086 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0015174basic amino acid transmembrane transporter activityTAS8954799 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006520amino acid metabolic processTAS8954799 
GO:0006810transportTAS8954799 
GO:0006865amino acid transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005624membrane fractionTAS8954799 
GO:0005737cytoplasmIDA18029348 
GO:0005887integral to plasma membraneTAS8954799 
GO:0016020membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/206192619331A,m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-15/16/195/424/49753515357m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-27235323591Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.