Gene Page: SLC18A2

Summary
GeneID  6571
Symbol  SLC18A2
Synonyms  MGC120477|MGC120478|MGC26538|SVAT|SVMT|VAT2|VMAT2
Description  solute carrier family 18 (vesicular monoamine), member 2
See related  HGNC:10935|MIM:193001|Ensembl:ENSG00000165646|HPRD:01896|
Locus tag  -
Gene type  protein-coding
Map location  10q25
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenics, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005215transporter activityIEA-
GO:0008504monoamine transmembrane transporter activityTAS8095030 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0015844monoamine transportTAS8095030 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005624membrane fractionTAS8095030 
GO:0005887integral to plasma membraneTAS8095030 
GO:0016020membraneIEA-
GO:0030659cytoplasmic vesicle membraneIEA-
GO:0031410cytoplasmic vesicleIEA-
 
KEGG Pathway Info
hsa05012: Parkinson's disease - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p214220m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-3811952011Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-5052062131A,m8hsa-miR-505GUCAACACUUGCUGGUUUCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.