Gene Page: SOX10

Summary
GeneID  6663
Symbol  SOX10
Synonyms  DOM|MGC15649|WS2E|WS4
Description  SRY (sex determining region Y)-box 10
See related  HGNC:11190|MIM:602229|Ensembl:ENSG00000100146|HPRD:03752|
Locus tag  RP5-1039K5.9
Gene type  protein-coding
Map location  22q13.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0003682chromatin bindingIEA-
GO:0003705RNA polymerase II transcription factor activity, enhancer bindingIEA-
GO:0003713transcription coactivator activityTAS9722528 
GO:0042802identical protein bindingIPI11029584 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001701in utero embryonic developmentIEA-
GO:0006350transcriptionIEA-
GO:0007422peripheral nervous system developmentIEA-
GO:0007605sensory perception of soundIEA-
GO:0009653anatomical structure morphogenesisTAS9425902 
GO:0030154cell differentiationIEA-
GO:0030318melanocyte differentiationIEA-
GO:0045944positive regulation of transcription from RNA polymerase II promoterIEA-
GO:0048469cell maturationIEA-
GO:0048484enteric nervous system developmentIEAneuron (GO term level: 7)-
GO:0048589developmental growthIEA-
GO:0048709oligodendrocyte differentiationIEAneuron, axon, oligodendrocyte, Glial (GO term level: 9)-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PAX3CDHS | HUP2 | MGC120381 | MGC120382 | MGC120383 | MGC120384 | MGC134778 | WS1paired box 3Pax3 interacts with Sox10.BIND11029584 
-HPRD,BioGRID10942418 |12668617 
POU3F2BRN2 | OCT7 | OTF7 | POUF3POU class 3 homeobox 2Brn-2 interacts with Sox10.BIND11029584 
SOX10DOM | MGC15649 | WS2E | WS4SRY (sex determining region Y)-box 10Sox10 forms a homodimer.BIND11029584 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-155114311491Ahsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.