Gene Page: SYCP1

Summary
GeneID  6847
Symbol  SYCP1
Synonyms  HOM-TES-14|MGC104417|SCP1
Description  synaptonemal complex protein 1
See related  HGNC:11487|MIM:602162|Ensembl:ENSG00000198765|HPRD:03698|
Locus tag  -
Gene type  protein-coding
Map location  1p13-p12
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingTAS1464329 
GO:0005515protein bindingIEA-
GO:0005515protein bindingISS15944401 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007049cell cycleIEA-
GO:0007126meiosisIEA-
GO:0007130synaptonemal complex assemblyIEASynap (GO term level: 11)-
GO:0007130synaptonemal complex assemblyISSSynap (GO term level: 11)15944401 
GO:0007131reciprocal meiotic recombinationTAS1464329 
GO:0007283spermatogenesisTAS1464329 
GO:0051301cell divisionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000801central elementIEA-
GO:0000802transverse filamentIEA-
GO:0005634nucleusIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1863203271A,m8hsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.