Gene Page: ACTC1

Summary
GeneID  70
Symbol  ACTC1
Synonyms  ACTC|CMD1R|CMH11
Description  actin, alpha, cardiac muscle 1
See related  HGNC:143|MIM:102540|Ensembl:ENSG00000159251|HPRD:00015|
Locus tag  -
Gene type  protein-coding
Map location  15q11-q14
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0172 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005198structural molecule activityIEA-
GO:0005515protein bindingIEA-
GO:0005524ATP bindingIDA16611632 
GO:0016887ATPase activityIDA16611632 |17765196 
GO:0017022myosin bindingIPI16611632 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006915apoptosisISS-
GO:0030048actin filament-based movementIDA16611632 
GO:0030240muscle thin filament assemblyISS-
GO:0031032actomyosin structure organizationISS-
GO:0055003cardiac myofibril assemblyISS-
GO:0055008cardiac muscle morphogenesisISS-
GO:0060047heart contractionIMP9563954 |17611253 |17947298 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005856cytoskeletonIEA-
GO:0031674I bandISS-
GO:0042643actomyosin, actin partIDA16611632 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABLIM3HMFN1661actin binding LIM protein family, member 3-HPRD,BioGRID15337165 
ABRASTARSactin-binding Rho activating protein-HPRD11983702 
ACTBPS1TP5BP1actin, beta-HPRD8913639 
ACTN4ACTININ-4 | DKFZp686K23158 | FSGS | FSGS1actinin, alpha 4-HPRD12042308 
ACTR2ARP2ARP2 actin-related protein 2 homolog (yeast)-HPRD,BioGRID12019562 
AFAP1AFAP | AFAP-110 | FLJ56849actin filament associated protein 1Reconstituted ComplexBioGRID12134071 
ANGALS9 | HEL168 | MGC22466 | MGC71966 | RNASE4 | RNASE5angiogenin, ribonuclease, RNase A family, 5-HPRD8127865 
CAPN1CANP | CANP1 | CANPL1 | muCANP | muCLcalpain 1, (mu/I) large subunitCAPN1 interacts with ACTC.BIND12358155 
CFL1CFLcofilin 1 (non-muscle)-HPRD12207032 
DMDBMD | CMD3B | DXS142 | DXS164 | DXS206 | DXS230 | DXS239 | DXS268 | DXS269 | DXS270 | DXS272dystrophin-HPRD11997265 
DYNLL1DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1dynein, light chain, LC8-type 1-HPRD14760703 
EPB49DMT | FLJ78462 | FLJ98848erythrocyte membrane protein band 4.9 (dematin)-HPRD12011427 
EZRCVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2ezrin-HPRD12271120 
FSCN1FLJ38511 | SNL | p55fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)-HPRD12139639 
GCDBP | DBP/GC | VDBG | VDBPgroup-specific component (vitamin D binding protein)-HPRD,BioGRID12452439 |12554937 
KLHL17RP11-54O7.6kelch-like 17 (Drosophila)-HPRD12063253 
KPTN2E4kaptin (actin binding protein)-HPRD12019562 
LASP1Lasp-1 | MLN50LIM and SH3 protein 1-HPRD9848085 
MIB2FLJ20648 | FLJ39787 | ZZANK1 | ZZZ5mindbomb homolog 2 (Drosophila)-HPRD14507647 
MYLKDKFZp686I10125 | FLJ12216 | KRP | MLCK | MLCK1 | MLCK108 | MLCK210 | MSTP083 | MYLK1 | smMLCKmyosin light chain kinase-HPRD12110694 
PLEC1EBS1 | EBSO | HD1 | PCN | PLEC1b | PLTNplectin 1, intermediate filament binding protein 500kDa-HPRD12136158 
PPP1R9BFLJ30345 | PPP1R6 | PPP1R9 | SPINO | Spnprotein phosphatase 1, regulatory (inhibitor) subunit 9B-HPRD12270929|12417592 
PRKCEMGC125656 | MGC125657 | PKCE | nPKC-epsilonprotein kinase C, epsilon-HPRD11968018 
SCINKIAA1905scinderin-HPRD12438125 
SYNE18B | CPG2 | DKFZp781J13156 | FLJ30878 | FLJ41140 | KIAA0796 | KIAA1262 | KIAA1756 | MYNE1 | SCAR8spectrin repeat containing, nuclear envelope 1-HPRD12408964 
SYNE2DKFZp434H2235 | DKFZp686E01115 | DKFZp686H1931 | FLJ11014 | FLJ43727 | FLJ45710 | FLJ46790 | KIAA1011 | NUA | NUANCE | Nesprin-2 | SYNE-2spectrin repeat containing, nuclear envelope 2-HPRD,BioGRID12118075 |12408964 
TNNI3KCARK | MGC142099 | MGC33828TNNI3 interacting kinase-HPRD,BioGRID12721663 
TWF1A6 | MGC23788 | MGC41876 | PTK9twinfilin, actin-binding protein, homolog 1 (Drosophila)-HPRD12207032 
WASIMD2 | THC | WASPWiskott-Aldrich syndrome (eczema-thrombocytopenia)-HPRD12029088 
WIPF1MGC111041 | PRPL-2 | WASPIP | WIPWAS/WASL interacting protein family, member 1-HPRD12029088 
 
KEGG Pathway Info
hsa05110: Vibrio cholerae infection - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p1481541Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-299-5p1571631Ahsa-miR-299-5pUGGUUUACCGUCCCACAUACAU
miR-30-5p1051121A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-495102108m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.