Gene Page: TIAL1

Summary
GeneID  7073
Symbol  TIAL1
Synonyms  MGC33401|TCBP|TIAR
Description  TIA1 cytotoxic granule-associated RNA binding protein-like 1
See related  HGNC:11804|MIM:603413|Ensembl:ENSG00000151923|HPRD:04563|
Locus tag  -
Gene type  protein-coding
Map location  10q
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003677DNA bindingNAS-
GO:0003702RNA polymerase II transcription factor activityTAS9207209 
GO:0003723RNA bindingTAS1326761 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006357regulation of transcription from RNA polymerase II promoterTAS9207209 
GO:0006915apoptosisIEA-
GO:0006917induction of apoptosisTAS1326761 
GO:0006952defense responseTAS1326761 
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
GO:0005764lysosomeTAS1326761 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.19799851Ahsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-141/200a807813m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-1495625681Ahsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-193208220881Ahsa-miR-193aAACUGGCCUACAAAGUCCCAG
hsa-miR-193bAACUGGCCCUCAAAGUCCCGCUUU
miR-200bc/429338344m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-203.16947011A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-363155415601Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-381114811541Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.