Gene Page: TSG101

Summary
GeneID  7251
Symbol  TSG101
Synonyms  TSG10|VPS23
Description  tumor susceptibility gene 101
See related  HGNC:15971|MIM:601387|Ensembl:ENSG00000074319|HPRD:03229|
Locus tag  -
Gene type  protein-coding
Map location  11p15
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.5 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingTAS10888872 
GO:0003714transcription corepressor activityTAS10888872 
GO:0005515protein bindingIPI12029088 |15033475 |17350572 
GO:0019787small conjugating protein ligase activityIEA-
GO:0043130ubiquitin bindingTAS15611048 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001558regulation of cell growthIEA-
GO:0015031protein transportIEA-
GO:0043162ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathwayIDA15611048 
GO:0043687post-translational protein modificationIEA-
GO:0044419interspecies interaction between organismsIEA-
GO:0051246regulation of protein metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIEA-
GO:0005771multivesicular bodyTAS15611048 
GO:0005886plasma membraneIDA18029348 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AATFCHE-1 | CHE1 | DEDapoptosis antagonizing transcription factor-HPRD14761944 
ARAIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFMandrogen receptor-HPRD,BioGRID10508170 
CDKN1ACAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1cyclin-dependent kinase inhibitor 1A (p21, Cip1)-HPRD,BioGRID11943869 
CEP55C10orf3 | FLJ10540 | URCC6centrosomal protein 55kDaTwo-hybridBioGRID16189514 
DMAP1DKFZp686L09142 | DNMAP1 | DNMTAP1 | EAF2 | FLJ11543 | KIAA1425 | SWC4DNA methyltransferase 1 associated protein 1-HPRD,BioGRID10888872 
DNMT1AIM | CXXC9 | DNMT | FLJ16293 | MCMT | MGC104992DNA (cytosine-5-)-methyltransferase 1-HPRD10888872 
EP300KAT3B | p300E1A binding protein p300-HPRD,BioGRID10440698 
GGA3KIAA0154golgi associated, gamma adaptin ear containing, ARF binding protein 3-HPRD,BioGRID15039775 
GMCL1BTBD13 | GCL | GCL1germ cell-less homolog 1 (Drosophila)-HPRD12927808 
HGSHRS | ZFYVE8hepatocyte growth factor-regulated tyrosine kinase substrateTSG101 interacts with HGS (Hrs).BIND14519844 
Affinity Capture-Western
Two-hybrid
BioGRID12802020 |16189514 
HRS interacts with TSG101.BIND12802020 
ITSN1ITSN | MGC134948 | MGC134949 | SH3D1A | SH3P17intersectin 1 (SH3 domain protein)Two-hybridBioGRID15256501 
KIF5AD12S1889 | MY050 | NKHC | SPG10kinesin family member 5ATwo-hybridBioGRID15256501 
KRT15CK15 | K15 | K1COkeratin 15Two-hybridBioGRID16189514 
LRSAM1FLJ31641 | RIFLE | TALleucine rich repeat and sterile alpha motif containing 1-HPRD,BioGRID15256501 
MDM2HDMX | MGC71221 | hdm2Mdm2 p53 binding protein homolog (mouse)-HPRD,BioGRID11172000 
NR3C1GCCR | GCR | GR | GRLnuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)-HPRD,BioGRID10508170 
PDCD6IPAIP1 | Alix | DRIP4 | HP95 | MGC17003programmed cell death 6 interacting proteinPDCD6IP (AIP1) interacts with Tsg101.BIND14505569 
TSG101 interacts with PDCD6IP (AIP-1/ALIX).BIND14519844 
PPFIBP2Cclp1 | DKFZp781K06126 | MGC42541PTPRF interacting protein, binding protein 2 (liprin beta 2)Two-hybridBioGRID16189514 
SCNN1AENaCa | ENaCalpha | FLJ21883 | SCNEA | SCNN1sodium channel, nonvoltage-gated 1 alphaTwo-hybridBioGRID14556380 
THRBERBA-BETA | ERBA2 | GRTH | MGC126109 | MGC126110 | NR1A2 | PRTH | THR1 | THRB1 | THRB2thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)Two-hybridBioGRID10508170 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD,BioGRID11172000 
TSG101TSG10 | VPS23tumor susceptibility gene 101TSG101 interacts with another TSG101 to form a homomultimer.BIND14519844 
Tsg101 interacts with Tsg101.BIND12900394 
VPS28MGC60323vacuolar protein sorting 28 homolog (S. cerevisiae)hVPS28 interacts with TSG101.BIND11134028 
VPS28 interacts with TSG101.BIND15218037 
TSG101 interacts with an unspecified isoform of VPS28.BIND14519844 
-HPRD11134028 |11916981 
Reconstituted Complex
Two-hybrid
BioGRID11134028 |15218037 
|16189514 
VPS37AFLJ32642 | FLJ42616 | HCRP1 | PQBP2vacuolar protein sorting 37 homolog A (S. cerevisiae)-HPRD,BioGRID15218037 |15240819 
VPS37A interacts with TSG101.BIND15218037 
VPS37BFLJ12750vacuolar protein sorting 37 homolog B (S. cerevisiae)VPS37B interacts with TSG101.BIND15218037 
Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID15218037 |15240819 
VPS37CFLJ20847vacuolar protein sorting 37 homolog C (S. cerevisiae)-HPRD,BioGRID15509564 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-17-5p/20/93.mr/106/519.d168174m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.