Gene Page: YWHAE

Summary
GeneID  7531
Symbol  YWHAE
Synonyms  14-3-3E|FLJ45465|KCIP-1|MDCR|MDS
Description  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide
See related  HGNC:12851|MIM:605066|Ensembl:ENSG00000108953|HPRD:05457|
Locus tag  -
Gene type  protein-coding
Map location  17p13.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.539 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0019899enzyme bindingIPI10788521 
GO:0019904protein domain specific bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006605protein targetingIEA-
GO:0007242intracellular signaling cascadeTAS7644510 
GO:0044419interspecies interaction between organismsIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005739mitochondrionIEA-
GO:0042470melanosomeIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGEF2DKFZp547L106 | DKFZp547P1516 | GEF | GEF-H1 | GEFH1 | KIAA0651 | LFP40 | P40rho/rac guanine nucleotide exchange factor (GEF) 2-HPRD14970201 
BADBBC2 | BCL2L8BCL2-associated agonist of cell death-HPRD,BioGRID9369453 
BIRC3AIP1 | API2 | CIAP2 | HAIP1 | HIAP1 | MALT2 | MIHC | RNF49baculoviral IAP repeat-containing 3The cIAP-2 promoter interacts with 14-3-3-epsilon.BIND15494311 
CALM1CALML2 | CAMI | DD132 | PHKDcalmodulin 1 (phosphorylase kinase, delta)-HPRD10088721 
CDC25ACDC25A2cell division cycle 25 homolog A (S. pombe)-HPRD,BioGRID7644510 
-HPRD7644510 |14559997 
14-3-3-epsilon interacts with cdc25A.BIND7644510 
CDC25B-cell division cycle 25 homolog B (S. pombe)-HPRD,BioGRID7644510 |10713667 
14-3-3-epsilon interacts with cdc25B.BIND7644510 
CDC25CCDC25cell division cycle 25 homolog C (S. pombe)Affinity Capture-WesternBioGRID10330186 
CDC2L1CDC2L2 | CDK11 | CDK11-p110 | CDK11-p46 | CDK11-p58 | CLK-1 | FLJ59152 | PK58 | p58 | p58CDC2L1 | p58CLK-1cell division cycle 2-like 1 (PITSLRE proteins)CDK11-p110 interacts with 14-3-3-epsilon.BIND15883043 
CDKN1BCDKN4 | KIP1 | MEN1B | MEN4 | P27KIP1cyclin-dependent kinase inhibitor 1B (p27, Kip1)-HPRD12042314 
GPRIN2GRIN2 | KIAA0514 | MGC15171G protein regulated inducer of neurite outgrowth 2Two-hybridBioGRID16189514 
GRAP2GADS | GRAP-2 | GRB2L | GRBLG | GRID | GRPL | GrbX | Grf40 | Mona | P38GRB2-related adaptor protein 2Two-hybridBioGRID16189514 
HDAC4HA6116 | HD4 | HDAC-A | HDACA | KIAA0288histone deacetylase 4Affinity Capture-Western
Reconstituted Complex
BioGRID10869435 |11504882 
-HPRD11486037 
HDAC5FLJ90614 | HD5 | NY-CO-9histone deacetylase 5-HPRD,BioGRID10869435 
IGF1RCD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216insulin-like growth factor 1 receptor-HPRD,BioGRID9111084 
IGFIR interacts with 14-3-3-epsilon isoform. This interaction is modeled on a demonstrated interaction between human IGFIR and mouse 14-3-3-epsilon isoformBIND9111084 
IRS1HIRS-1insulin receptor substrate 1IRS-1 interacts with 14-3-3-epsilon isoform. This interaction was modeled on a demonstrated interaction between human IRS-1 and mouse 14-3-3-epsilon isoform.BIND9111084 
-HPRD,BioGRID9111084 |9312143 
IRS2-insulin receptor substrate 2-HPRD,BioGRID9312143 
KCNH2ERG1 | HERG | HERG1 | Kv11.1 | LQT2 | SQT1potassium voltage-gated channel, subfamily H (eag-related), member 2-HPRD,BioGRID11953308 
KIF1CKIAA0706 | LTXS1kinesin family member 1C-HPRD10559254 
KRT18CYK18 | K18keratin 18-HPRD9524113 
MAP3K1MAPKKK1 | MEKK | MEKK1mitogen-activated protein kinase kinase kinase 1Reconstituted ComplexBioGRID9452471 
MAP3K10MLK2 | MSTmitogen-activated protein kinase kinase kinase 10-HPRD,BioGRID9427749 
MAP3K2MEKK2 | MEKK2Bmitogen-activated protein kinase kinase kinase 2-HPRD,BioGRID9452471 
MAP3K3MAPKKK3 | MEKK3mitogen-activated protein kinase kinase kinase 3-HPRD,BioGRID9452471 
MAP3K7IP2FLJ21885 | KIAA0733 | TAB2mitogen-activated protein kinase kinase kinase 7 interacting protein 2-HPRD14743216 
MAPK7BMK1 | ERK4 | ERK5 | PRKM7mitogen-activated protein kinase 7Two-hybridBioGRID14679215 
NCOR2CTG26 | SMRT | SMRTE | SMRTE-tau | TNRC14 | TRAC-1 | TRAC1nuclear receptor co-repressor 214-3-3-epsilon interacts with SMRT.BIND15494311 
NDEL1DKFZp451M0318 | EOPA | MITAP1 | NUDELnudE nuclear distribution gene E homolog (A. nidulans)-like 1-HPRD,BioGRID12796778 
NGFRAP1BEX3 | Bex | DXS6984E | HGR74 | NADEnerve growth factor receptor (TNFRSF16) associated protein 1-HPRD,BioGRID11278287 
PAPOLAMGC5378 | PAPpoly(A) polymerase alpha-HPRD14517258 
PCTK1FLJ16665 | PCTAIRE | PCTAIRE1 | PCTGAIREPCTAIRE protein kinase 1-HPRD12154078 
RAF1CRAF | NS5 | Raf-1 | c-Rafv-raf-1 murine leukemia viral oncogene homolog 1-HPRD,BioGRID7644510 
14-3-3-epsilon interacts with Raf-1.BIND7644510 
RASGRF1CDC25 | CDC25L | GNRP | GRF1 | GRF55 | H-GRF55 | PP13187Ras protein-specific guanine nucleotide-releasing factor 1-HPRD11533041 
REM1GD:REM | GES | MGC48669 | REMRAS (RAD and GEM)-like GTP-binding 1-HPRD,BioGRID10441394 
RGNEFDKFZp686P12164 | FLJ21817 | KIAA1998Rho-guanine nucleotide exchange factor-HPRD11533041 
RGS3C2PA | FLJ20370 | FLJ31516 | FLJ90496 | PDZ-RGS3 | RGP3regulator of G-protein signaling 3-HPRD11985497 
RIN1-Ras and Rab interactor 1-HPRD9144171 |11784866 
SNCAMGC110988 | NACP | PARK1 | PARK4 | PD1synuclein, alpha (non A4 component of amyloid precursor)-HPRD10407019 
SORBS2ARGBP2 | FLJ93447 | KIAA0777 | PRO0618sorbin and SH3 domain containing 2Two-hybridBioGRID16189514 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)-HPRD8702721 
SYN2SYNII | SYNIIa | SYNIIbsynapsin IITwo-hybridBioGRID10358015 
TGFB1CED | DPD1 | TGFB | TGFbetatransforming growth factor, beta 1-HPRD,BioGRID11172812 
TNFAIP3A20 | MGC104522 | MGC138687 | MGC138688 | OTUD7C | TNFA1P2tumor necrosis factor, alpha-induced protein 3-HPRD,BioGRID8702721 
TOP2ATOP2 | TP2Atopoisomerase (DNA) II alpha 170kDa-HPRD,BioGRID10788521 
TSC1KIAA0243 | LAM | MGC86987 | TSCtuberous sclerosis 1Hamartin interacts with 14-3-3-epsilon.BIND12176984 
TSC2FLJ43106 | LAM | TSC4tuberous sclerosis 2-HPRD12438239 
Tumor suppressor protein tuberin interacts with 14-3-3-epsilon isoform. This interaction is modeled on demonstrated interaction between human tuberin and mouse 14-3-3-epsilon isoform.BIND12176984 
WWTR1DKFZp586I1419 | TAZWW domain containing transcription regulator 1-HPRD11118213 
 
KEGG Pathway Info
hsa04110: Cell cycle - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-155266272m8hsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
miR-1862272331Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-267777831Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-30-3p5605661Ahsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
hsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
miR-31608614m8hsa-miR-31AGGCAAGAUGCUGGCAUAGCUG
miR-320216222m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-4906366421Ahsa-miR-490CAACCUGGAGGACUCCAUGCUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.