Gene Page: YWHAG

Summary
GeneID  7532
Symbol  YWHAG
Synonyms  14-3-3GAMMA
Description  tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
See related  HGNC:12852|MIM:605356|Ensembl:ENSG00000170027|HPRD:05639|
Locus tag  -
Gene type  protein-coding
Map location  7q11.23
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 1.9874 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005080protein kinase C bindingIPI10433554 
GO:0005159insulin-like growth factor receptor bindingIPI12482592 
GO:0008426protein kinase C inhibitor activityNAS10433554 
GO:0019904protein domain specific bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006469negative regulation of protein kinase activityNAS10433554 
GO:0006605protein targetingIEA-
GO:0009966regulation of signal transductionNAS10433554 |10486217 
GO:0045664regulation of neuron differentiationIMPneuron, neurogenesis (GO term level: 9)11824616 
GO:0048167regulation of synaptic plasticityIMPSynap (GO term level: 8)11824616 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AKAP13AKAP-Lbc | BRX | FLJ11952 | FLJ43341 | HA-3 | Ht31 | LBC | PROTO-LB | PROTO-LBC | c-lbcA kinase (PRKA) anchor protein 13-HPRD15324660 
ANKS1AANKS1 | KIAA0229 | MGC42354ankyrin repeat and sterile alpha motif domain containing 1A-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
ARAFA-RAF | ARAF1 | PKS2 | RAFA1v-raf murine sarcoma 3611 viral oncogene homologAffinity Capture-MSBioGRID17353931 
ARHGEF2DKFZp547L106 | DKFZp547P1516 | GEF | GEF-H1 | GEFH1 | KIAA0651 | LFP40 | P40rho/rac guanine nucleotide exchange factor (GEF) 2-HPRD15324660 
ATP5A1ATP5A | ATP5AL2 | ATPM | MOM2 | OMR | ORM | hATP1ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle-HPRD15324660 
BAIAP2BAP2 | IRSP53BAI1-associated protein 2Affinity Capture-MSBioGRID17353931 
BCLAF1BTF | KIAA0164 | bK211L9.1BCL2-associated transcription factor 1-HPRD15324660 
BRAFB-RAF1 | BRAF1 | FLJ95109 | MGC126806 | MGC138284 | RAFB1v-raf murine sarcoma viral oncogene homolog B1Affinity Capture-MSBioGRID17353931 
C22orf9-chromosome 22 open reading frame 9Affinity Capture-MSBioGRID17353931 
CAPN3CANP3 | CANPL3 | LGMD2 | LGMD2A | MGC10767 | MGC11121 | MGC14344 | MGC4403 | nCL-1 | p94calpain 3, (p94)-HPRD15324660 
CDC2L1CDC2L2 | CDK11 | CDK11-p110 | CDK11-p46 | CDK11-p58 | CLK-1 | FLJ59152 | PK58 | p58 | p58CDC2L1 | p58CLK-1cell division cycle 2-like 1 (PITSLRE proteins)CDK11-p110 interacts with 14-3-3-gamma.BIND15883043 
CGNDKFZp779N1112 | FLJ39281 | KIAA1319cingulin-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
CLASP1DKFZp686D1968 | DKFZp686H2039 | FLJ33821 | FLJ41222 | KIAA0622 | MAST1 | MGC131895cytoplasmic linker associated protein 1Affinity Capture-MSBioGRID17353931 
CLK2MGC61500 | hCLK2CDC-like kinase 2-HPRD15324660 
CLK3FLJ22858 | PHCLK3 | PHCLK3/152CDC-like kinase 3-HPRD15324660 
CROPLUC7A | OA48-18cisplatin resistance-associated overexpressed protein-HPRD15324660 
CRTC2RP11-422P24.6 | TORC2CREB regulated transcription coactivator 2Affinity Capture-MSBioGRID17353931 
-HPRD15324660 
CSE1LCAS | CSE1 | MGC117283 | MGC130036 | MGC130037 | XPO2CSE1 chromosome segregation 1-like (yeast)-HPRD15324660 
DENND4AFLJ33949 | IRLB | KIAA0476 | MYCPBPDENN/MADD domain containing 4AAffinity Capture-MSBioGRID17353931 
DFFADFF-45 | DFF1 | ICADDNA fragmentation factor, 45kDa, alpha polypeptide-HPRD15324660 
DISC1C1orf136 | FLJ13381 | FLJ21640 | FLJ25311 | FLJ41105 | KIAA0457 | SCZD9disrupted in schizophrenia 1-HPRD,BioGRID12506198 
DOCK7KIAA1771 | ZIR2dedicator of cytokinesis 7-HPRD15324660 
DYRK1ADYRK | DYRK1 | HP86 | MNB | MNBHdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A-HPRD15324660 
EDC3FLJ21128 | FLJ31777 | LSM16 | YJDC | YJEFN2enhancer of mRNA decapping 3 homolog (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
EEF1GEF1G | GIG35eukaryotic translation elongation factor 1 gamma-HPRD15324660 
EPB41L34.1B | DAL-1 | DAL1 | FLJ37633 | KIAA0987erythrocyte membrane protein band 4.1-like 3-HPRD,BioGRID11996670 
ERC1Cast2 | ELKS | KIAA1081 | MGC12974 | RAB6IP2ELKS/RAB6-interacting/CAST family member 1-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
FAM82A2FAM82C | FLJ10579 | RMD3 | hRMD-3 | ptpip51family with sequence similarity 82, member A2Affinity Capture-MSBioGRID17353931 
FARP2FIR | FRG | KIAA0793 | PLEKHC3FERM, RhoGEF and pleckstrin domain protein 2-HPRD15324660 
FOXO1FKH1 | FKHR | FOXO1Aforkhead box O1-HPRD,BioGRID11237865 
FRMD6C14orf31 | EX1 | MGC17921 | Willin | c14_5320FERM domain containing 6-HPRD15324660 
FRYLDKFZp686E205 | FLJ16177 | KIAA0826FRY-likeAffinity Capture-MSBioGRID17353931 
GBF1FLJ21263 | FLJ21500 | KIAA0248 | MGC134877 | MGC134878golgi-specific brefeldin A resistance factor 1Affinity Capture-MSBioGRID17353931 
HDAC4HA6116 | HD4 | HDAC-A | HDACA | KIAA0288histone deacetylase 4Reconstituted ComplexBioGRID11504882 
IGF1RCD221 | IGFIR | JTK13 | MGC142170 | MGC142172 | MGC18216insulin-like growth factor 1 receptorAffinity Capture-MSBioGRID17353931 
IRS2-insulin receptor substrate 2Affinity Capture-MSBioGRID17353931 
KIAA0408FLJ43995 | RP3-403A15.2KIAA0408Two-hybridBioGRID16189514 
KIF1BCMT2 | CMT2A | CMT2A1 | FLJ23699 | HMSNII | KIAA0591 | KIAA1448 | KLP | MGC134844kinesin family member 1B-HPRD15324660 
KIF1CKIAA0706 | LTXS1kinesin family member 1C-HPRD,BioGRID10559254 
KIF23CHO1 | KNSL5 | MKLP-1 | MKLP1kinesin family member 23Affinity Capture-MSBioGRID17353931 
-HPRD15324660 
KIF5BKINH | KNS | KNS1 | UKHCkinesin family member 5BAffinity Capture-MSBioGRID17353931 
KIF5CFLJ44735 | KIAA0531 | KINN | MGC111478 | NKHC | NKHC-2 | NKHC2kinesin family member 5CAffinity Capture-MSBioGRID17353931 
KLC1KLC | KNS2 | KNS2A | MGC15245kinesin light chain 1Affinity Capture-MSBioGRID17353931 
KLC2FLJ12387kinesin light chain 2Affinity Capture-MSBioGRID17353931 
KLC3KLC2 | KLC2L | KLCt | KNS2Bkinesin light chain 3Affinity Capture-MSBioGRID17353931 
-HPRD15324660 
KLC4KNSL8 | MGC111777 | bA387M24.3kinesin light chain 4Affinity Capture-MSBioGRID17353931 
KRT18CYK18 | K18keratin 18-HPRD9524113 
KRT31HA1 | Ha-1 | KRTHA1 | MGC138630 | hHa1keratin 31Affinity Capture-MSBioGRID17353931 
KRT33BHA3II | Ha-3II | KRTHA3A | KRTHA3B | hHa3-IIkeratin 33BAffinity Capture-MSBioGRID17353931 
KRT85HB5 | Hb-5 | KRTHB5 | hHb5keratin 85Affinity Capture-MSBioGRID17353931 
LARP1KIAA0731 | LARP | MGC19556La ribonucleoprotein domain family, member 1Affinity Capture-MSBioGRID17353931 
-HPRD15324660 
LBRDHCR14B | FLJ43126 | LMN2R | MGC9041 | PHAlamin B receptorAffinity Capture-MSBioGRID17353931 
LSRLISCH7 | MGC10659 | MGC48312 | MGC48503lipolysis stimulated lipoprotein receptor-HPRD15324660 
LUC7L2CGI-59 | CGI-74 | FLJ10657 | LUC7B2LUC7-like 2 (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
-HPRD15324660 
MAP3K2MEKK2 | MEKK2Bmitogen-activated protein kinase kinase kinase 2-HPRD15324660 
MAP3K3MAPKKK3 | MEKK3mitogen-activated protein kinase kinase kinase 3Affinity Capture-MSBioGRID14743216 
MARK2EMK1 | MGC99619 | PAR-1 | Par1bMAP/microtubule affinity-regulating kinase 2Affinity Capture-MSBioGRID17353931 
MARK3CTAK1 | KP78 | PAR1AMAP/microtubule affinity-regulating kinase 3Affinity Capture-MSBioGRID17353931 
MICALL1DKFZp686M2226 | FLJ45921 | KIAA1668 | MICAL-L1 | MIRAB13MICAL-like 1-HPRD15324660 
MLLT4AF-6 | AF6 | AFADIN | FLJ34371 | RP3-431P23.3myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4Affinity Capture-MSBioGRID17353931 
MPRIPKIAA0864 | M-RIP | RHOIP3 | p116Ripmyosin phosphatase Rho interacting proteinAffinity Capture-MSBioGRID17353931 
-HPRD15324660 
MYCBP2DKFZp686M08244 | FLJ10106 | FLJ13826 | FLJ21597 | FLJ21646 | KIAA0916 | PAMMYC binding protein 2-HPRD15324660 
OSBPL3DKFZp667P1518 | KIAA0704 | MGC21526 | ORP-3 | ORP3 | OSBP3oxysterol binding protein-like 3Affinity Capture-MSBioGRID17353931 
PAK4-p21 protein (Cdc42/Rac)-activated kinase 4Affinity Capture-MSBioGRID17353931 
PARD3ASIP | Baz | Bazooka | FLJ21015 | PAR3 | PAR3alpha | PARD3A | SE2-5L16 | SE2-5LT1 | SE2-5T2par-3 partitioning defective 3 homolog (C. elegans)Affinity Capture-MSBioGRID17353931 
PARD3BALS2CR19 | MGC16131 | PAR3B | PAR3L | PAR3LC | PAR3beta | Par3Lbpar-3 partitioning defective 3 homolog B (C. elegans)-HPRD15324660 
PCTK1FLJ16665 | PCTAIRE | PCTAIRE1 | PCTGAIREPCTAIRE protein kinase 1-HPRD,BioGRID12154078 
PI4KBPI4K-BETA | PI4KIIIbeta | PI4Kbeta | PIK4CB | pi4K92phosphatidylinositol 4-kinase, catalytic, betaAffinity Capture-MSBioGRID17353931 
-HPRD15324660 
PNNDRS | SDK3 | memA | pininpinin, desmosome associated protein-HPRD15324660 
PPFIBP1L2 | hSGT2 | hSgt2pPTPRF interacting protein, binding protein 1 (liprin beta 1)Affinity Capture-MSBioGRID17353931 
PPIGCARS-Cyp | CYP | MGC133241 | SRCyppeptidylprolyl isomerase G (cyclophilin G)-HPRD15324660 
PRKCAAAG6 | MGC129900 | MGC129901 | PKC-alpha | PKCA | PRKACAprotein kinase C, alpha-HPRD,BioGRID10433554 
PRKCBMGC41878 | PKC-beta | PKCB | PRKCB1 | PRKCB2protein kinase C, beta-HPRD,BioGRID10433554 
PRKCDMAY1 | MGC49908 | PKCD | nPKC-deltaprotein kinase C, delta-HPRD,BioGRID10433554 
PRKCGMGC57564 | PKC-gamma | PKCC | PKCG | SCA14protein kinase C, gamma-HPRD,BioGRID10433554 
PRKCQMGC126514 | MGC141919 | PRKCT | nPKC-thetaprotein kinase C, theta-HPRD,BioGRID10433554 
PRKCZPKC-ZETA | PKC2protein kinase C, zetaAffinity Capture-WesternBioGRID10620507 
PRPF19NMP200 | PRP19 | PSO4 | SNEV | UBOX4 | hPSO4PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)-HPRD15324660 
PRPF40AFBP-11 | FBP11 | FLAF1 | FLJ20585 | FNBP3 | HIP10 | HYPA | NY-REN-6PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)-HPRD15324660 
PRPF4BKIAA0536 | PR4H | PRP4 | PRP4H | PRP4K | dJ1013A10.1PRP4 pre-mRNA processing factor 4 homolog B (yeast)Affinity Capture-MSBioGRID17353931 
RAB11FIP2KIAA0941 | Rab11-FIP2 | nRip11RAB11 family interacting protein 2 (class I)-HPRD15324660 
RABEP1RAB5EP | RABPT5rabaptin, RAB GTPase binding effector protein 1Affinity Capture-MSBioGRID17353931 
RABGEF1FLJ32302 | RABEX5 | rabex-5RAB guanine nucleotide exchange factor (GEF) 1-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
RACGAP1HsCYK-4 | ID-GAP | MgcRacGAPRac GTPase activating protein 1Affinity Capture-MSBioGRID17353931 
RAF1CRAF | NS5 | Raf-1 | c-Rafv-raf-1 murine leukemia viral oncogene homolog 1-HPRD8702721 |10433554 
Affinity Capture-MS
Affinity Capture-Western
BioGRID10433554 |10620507 
|17353931 
RAI14DKFZp564G013 | KIAA1334 | NORPEG | RAI13retinoic acid induced 14Affinity Capture-MSBioGRID17353931 
RALGPS2FLJ10244 | FLJ25604 | KIAA0351 | dJ595C2.1Ral GEF with PH domain and SH3 binding motif 2-HPRD15324660 
RASAL2MGC129919 | nGAPRAS protein activator like 2-HPRD15324660 
SAMD4ADKFZp434H0350 | KIAA1053 | SAMD4 | SMG | SMGA | Smaug | Smaug1sterile alpha motif domain containing 4A-HPRD15324660 
SAMD4BFLJ10211 | MGC99832 | SMGBsterile alpha motif domain containing 4B-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
SF3B3KIAA0017 | RSE1 | SAP130 | SF3b130 | STAF130splicing factor 3b, subunit 3, 130kDa-HPRD15324660 
SFNYWHASstratifinAffinity Capture-MSBioGRID15778465 
SH3BP5LFLJ33845 | KIAA1720SH3-binding domain protein 5-like-HPRD15324660 
SHCBP1FLJ22009 | MGC26900 | PALSHC SH2-domain binding protein 1-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
SMCR7LFLJ20232 | HSU79252 | dJ1104E15.3Smith-Magenis syndrome chromosome region, candidate 7-like-HPRD15324660 
SNRNP200ASCC3L1 | BRR2 | HELIC2 | U5-200KDsmall nuclear ribonucleoprotein 200kDa (U5)Affinity Capture-MSBioGRID17353931 
SONBASS1 | C21orf50 | DBP-5 | FLJ21099 | FLJ33914 | KIAA1019 | NREBP | SON3SON DNA binding protein-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
SRCASV | SRC1 | c-SRC | p60-Srcv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)-HPRD8702721 
SRPK1SFRSK1SFRS protein kinase 1-HPRD15324660 
SRRM1160-KD | MGC39488 | POP101 | SRM160serine/arginine repetitive matrix 1-HPRD15324660 
SRRM2300-KD | CWF21 | DKFZp686O15166 | FLJ21926 | FLJ22250 | KIAA0324 | MGC40295 | SRL300 | SRm300serine/arginine repetitive matrix 2Affinity Capture-MSBioGRID17353931 
TBC1D1KIAA1108 | TBC | TBC1TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1-HPRD15324660 
TJP2MGC26306 | X104 | ZO-2 | ZO2tight junction protein 2 (zona occludens 2)-HPRD15324660 
Affinity Capture-MSBioGRID17353931 
TNFAIP3A20 | MGC104522 | MGC138687 | MGC138688 | OTUD7C | TNFA1P2tumor necrosis factor, alpha-induced protein 3-HPRD8702721 
TSC1KIAA0243 | LAM | MGC86987 | TSCtuberous sclerosis 1Hamartin interacts with 14-3-3-gamma. This interaction is modeled on demonstrated interaction between human hamartin and mouse 14-3-3-gamma isoform.BIND12176984 
TSC2FLJ43106 | LAM | TSC4tuberous sclerosis 2-HPRD12438239 
The tumor suppressor protein tuberin interacts with 14-3-3-gamma isoform. This interaction is modeled on demonstrated interaction between human tuberin and mouse 14-3-3-gamma.BIND12176984 
UCP2BMIQ4 | SLC25A8 | UCPHuncoupling protein 2 (mitochondrial, proton carrier)UCP2 interacts with 14.3.3-gamma.BIND10785390 
UCP3SLC25A9uncoupling protein 3 (mitochondrial, proton carrier)UCP3 interacts with 14.3.3-gamma.BIND10785390 
ZFP36G0S24 | GOS24 | NUP475 | RNF162A | TIS11 | TTPzinc finger protein 36, C3H type, homolog (mouse)-HPRD11886850 
ZNF295DKFZp781N1974 | ZBTB21zinc finger protein 295-HPRD15324660 
 
KEGG Pathway Info
hsa04110: Cell cycle - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-132/212232238m8hsa-miR-212SZUAACAGUCUCCAGUCACGGCC
hsa-miR-132brainUAACAGUCUACAGCCAUGGUCG
miR-135623629m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-13922832289m8hsa-miR-139brainUCUACAGUGCACGUGUCU
miR-141/200a249024971A,m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-145199319991Ahsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-18127222728m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-1821581651A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-200bc/429590596m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-204/2118894m8hsa-miR-204brainUUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211UUCCCUUUGUCAUCCUUCGCCU
miR-21724422448m8hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-221/22227372743m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-2327242730m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-30-5p5855911Ahsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-323272427301Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-324-3p260726131Ahsa-miR-324-3pCCACUGCCCCAGGUGCUGCUGG
miR-433-3p271827251A,m8hsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
miR-485-5p2122191A,m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
miR-961591651Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.