Gene Page: CA2

Summary
GeneID  760
Symbol  CA2
Synonyms  CA-II|CAII|Car2
Description  carbonic anhydrase II
See related  HGNC:1373|MIM:611492|Ensembl:ENSG00000104267|HPRD:02023|
Locus tag  -
Gene type  protein-coding
Map location  8q22
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004089carbonate dehydratase activityTAS1928091 
GO:0008270zinc ion bindingIDA3151020 
GO:0016829lyase activityIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0002009morphogenesis of an epitheliumIEA-
GO:0006730one-carbon compound metabolic processIEA-
GO:0015670carbon dioxide transportIEA-
GO:0046903secretionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA18029348 
GO:0005737cytoplasmIDA114507 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DYNLL1DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1dynein, light chain, LC8-type 1-HPRD14760703 
HSPD1CPN60 | GROEL | HSP60 | HSP65 | HuCHA60 | SPG13heat shock 60kDa protein 1 (chaperonin)-HPRD,BioGRID9890926 |10811634 
NONONMT55 | NRB54 | P54 | P54NRBnon-POU domain containing, octamer-bindingReconstituted ComplexBioGRID10821857 
SLC4A1AE1 | BND3 | CD233 | DI | EMPB3 | EPB3 | FR | MGC116750 | MGC116753 | MGC126619 | MGC126623 | RTA1A | SW | WD | WD1 | WRsolute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)-HPRD,BioGRID9774471 |10820026 
|11063570 
SLC4A3AE3 | SLC2Csolute carrier family 4, anion exchanger, member 3-HPRD11606574 
SLC4A4DKFZp781H1314 | HNBC1 | KNBC | NBC1 | NBC2 | SLC4A5 | hhNMC | pNBCsolute carrier family 4, sodium bicarbonate cotransporter, member 4-HPRD12411514 
SLC4A8DKFZp761B2318 | FLJ46462 | NBC3solute carrier family 4, sodium bicarbonate cotransporter, member 8-HPRD,BioGRID14736710 
SLC9A1APNH | FLJ42224 | NHE1solute carrier family 9 (sodium/hydrogen exchanger), member 1-HPRD,BioGRID12138085 
 
KEGG Pathway Info
hsa00910: Nitrogen metabolism - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2185662m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-231481551A,m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-3231481541Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-4104995051Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.