Gene Page: FZD5

Summary
GeneID  7855
Symbol  FZD5
Synonyms  C2orf31|DKFZp434E2135|HFZ5|MGC129692
Description  frizzled homolog 5 (Drosophila)
See related  HGNC:4043|MIM:601723|Ensembl:ENSG00000163251|HPRD:03427|
Locus tag  -
Gene type  protein-coding
Map location  2q33-q34
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00916 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01016 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityTAS9054360 
GO:0004926non-G-protein coupled 7TM receptor activityIEA-
GO:0004930G-protein coupled receptor activityIEA-
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007164establishment of tissue polarityTAS8626800 
GO:0007186G-protein coupled receptor protein signaling pathwayIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0016055Wnt receptor signaling pathwayIEA-
GO:0048469cell maturationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIEA-
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS9054360 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GOPCCAL | FIG | GOPC1 | PIST | dJ94G16.2golgi associated PDZ and coiled-coil motif containing-HPRD11520064 
WNT5AhWNT5Awingless-type MMTV integration site family, member 5A-HPRD9054360 
 
KEGG Pathway Info
hsa04310: Wnt signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04916: Melanogenesis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05210: Colorectal cancer - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05217: Basal cell carcinoma - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.129983004m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/506299730041A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-140115011571A,m8hsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-149126812741Ahsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-155435543611Ahsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
miR-1917783m8hsa-miR-191brainCAACGGAAUCCCAAAAGCAGCU
miR-194373837441Ahsa-miR-194UGUAACAGCAACUCCAUGUGGA
miR-219401540221A,m8hsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-22438203826m8hsa-miR-224CAAGUCACUAGUGGUUCCGUUUA
miR-234264331A,m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-24385938661A,m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-3234264321Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-32632763282m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-330338733931Ahsa-miR-330brainGCAAAGCACACGGCCUGCAGAGA
miR-34234553461m8hsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
miR-369-3p422642331A,m8hsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37442274233m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-375120912151Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-378*351435211A,m8hsa-miR-422bCUGGACUUGGAGUCAGAAGGCC
hsa-miR-422aCUGGACUUAGGGUCAGAAGGCC
miR-381329633021Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-384328332901A,m8hsa-miR-384AUUCCUAGAAAUUGUUCAUA
miR-421386838751A,m8hsa-miR-421GGCCUCAUUAAAUGUUUGUUG
miR-455387238791A,m8hsa-miR-455UAUGUGCCUUUGGACUACAUCG
miR-99/10038313837m8hsa-miR-99abrainAACCCGUAGAUCCGAUCUUGUG
hsa-miR-100brainAACCCGUAGAUCCGAACUUGUG
hsa-miR-99bbrainCACCCGUAGAACCGACCUUGCG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.