Gene Page: CAMK2A

Summary
GeneID  815
Symbol  CAMK2A
Synonyms  CAMKA|KIAA0968
Description  calcium/calmodulin-dependent protein kinase II alpha
See related  HGNC:1460|MIM:114078|Ensembl:ENSG00000070808|HPRD:06532|
Locus tag  -
Gene type  protein-coding
Map location  5q33.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0032 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01718 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00459 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1782 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0004683calmodulin-dependent protein kinase activityIEA-
GO:0005516calmodulin bindingIEA-
GO:0005524ATP bindingIC17052756 
GO:0005524ATP bindingIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006468protein amino acid phosphorylationIDA17052756 
GO:0006468protein amino acid phosphorylationIEA-
GO:0051092positive regulation of NF-kappaB transcription factor activityIMP17052756 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneIEA-
GO:0005954calcium- and calmodulin-dependent protein kinase complexTAS11264466 
GO:0030054cell junctionIEA-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTN4ACTININ-4 | DKFZp686K23158 | FSGS | FSGS1actinin, alpha 4CAMK2A (CaMKII-alpha) interacts with ACTN4 (alpha-Actinin 4).BIND11160423 
Two-hybridBioGRID11160423 
ATF1EWS-ATF1 | FUS/ATF-1 | TREB36activating transcription factor 1Biochemical ActivityBioGRID8663317 
CALM3PHKD | PHKD3calmodulin 3 (phosphorylase kinase, delta)Affinity Capture-MSBioGRID17353931 
CAMK2BCAM2 | CAMK2 | CAMKB | MGC29528calcium/calmodulin-dependent protein kinase II betaAffinity Capture-MSBioGRID17353931 
CAMK2DCAMKD | DKFZp686G23119 | DKFZp686I2288 | MGC44911calcium/calmodulin-dependent protein kinase II deltaAffinity Capture-MSBioGRID17353931 
CAMK2N2CAM-KIIN | CAMKIINcalcium/calmodulin-dependent protein kinase II inhibitor 2-HPRD9724800 
CDK5R1CDK5P35 | CDK5R | MGC33831 | NCK5A | p23 | p25 | p35 | p35nck5acyclin-dependent kinase 5, regulatory subunit 1 (p35)-HPRD,BioGRID12223541 
CHMP5C9orf83 | CGI-34 | HSPC177 | PNAS-2 | SNF7DC2chromatin modifying protein 5Affinity Capture-MSBioGRID17353931 
CREB1CREB | MGC9284cAMP responsive element binding protein 1Biochemical ActivityBioGRID8663317 
DAPK2DRP-1 | MGC119312death-associated protein kinase 2-HPRD10629061 
DLG1DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlgdiscs, large homolog 1 (Drosophila)-HPRD,BioGRID12933808 
DLG3KIAA1232 | MRX | MRX90 | NE-Dlg | NEDLG | SAP102discs, large homolog 3 (neuroendocrine-dlg, Drosophila)Affinity Capture-MSBioGRID17353931 
GRIN1NMDA1 | NMDAR1 | NR1glutamate receptor, ionotropic, N-methyl D-aspartate 1-HPRD10862698 
GRIN2BMGC142178 | MGC142180 | NMDAR2B | NR2B | hNR3glutamate receptor, ionotropic, N-methyl D-aspartate 2B-HPRD,BioGRID11459059 
ITPKAIP3KAinositol 1,4,5-trisphosphate 3-kinase A-HPRD,BioGRID11468283 
LRRC7DKFZp686I1147 | KIAA1365 | MGC144918leucine rich repeat containing 7-HPRD11160423 
LRRC7 (Densin-180) interacts with CAMK2A (CaMKII-alpha). This interaction was modeled on a demonstrated interaction between rat LRCC7 and human CAMK2A.BIND11160423 
PARK2AR-JP | LPRS2 | PDJ | PRKNParkinson disease (autosomal recessive, juvenile) 2, parkinAffinity Capture-WesternBioGRID11679592 
RIMS1CORD7 | KIAA0340 | MGC167823 | MGC176677 | RAB3IP2 | RIM | RIM1regulating synaptic membrane exocytosis 1Biochemical ActivityBioGRID12871946 
SYNGAP1DKFZp761G1421 | KIAA1938 | RASA1 | RASA5 | SYNGAPsynaptic Ras GTPase activating protein 1 homolog (rat)-HPRD11278737 |12951199 
TANC1KIAA1728 | ROLSB | TANCtetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1-HPRD15673434 
 
KEGG Pathway Info
hsa04012: ErbB signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04020: Calcium signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04310: Wnt signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04720: Long-term potentiation - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04740: Olfactory transduction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04912: GnRH signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04916: Melanogenesis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05214: Glioma - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p149915061A,m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-148/15214791485m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-26310031061Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-27309431001Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-331273227381Ahsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-33888941Ahsa-miR-338brainUCCAGCAUCAGUGAUUUUGUUGA
miR-495302430301Ahsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.