Gene Page: CAMK2D

Summary
GeneID  817
Symbol  CAMK2D
Synonyms  CAMKD|DKFZp686G23119|DKFZp686I2288|MGC44911
Description  calcium/calmodulin-dependent protein kinase II delta
See related  HGNC:1462|MIM:607708|Ensembl:ENSG00000145349|HPRD:09653|
Locus tag  -
Gene type  protein-coding
Map location  4q26
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0238 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0004674protein serine/threonine kinase activityIEA-
GO:0004683calmodulin-dependent protein kinase activityIEA-
GO:0005516calmodulin bindingIEA-
GO:0005524ATP bindingIEA-
GO:0005524ATP bindingNAS-
GO:0016301kinase activityIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001558regulation of cell growthNAS9060999 
GO:0006468protein amino acid phosphorylationIEA-
GO:0006468protein amino acid phosphorylationNAS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005954calcium- and calmodulin-dependent protein kinase complexTAS11264466 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CAMK2ACAMKA | KIAA0968calcium/calmodulin-dependent protein kinase II alphaAffinity Capture-MSBioGRID17353931 
CD5LEU1 | T1CD5 moleculein vitro
Two-hybrid
BioGRID9692886 
RPS18D6S218E | HKE3 | KE-3 | KE3 | MGC117351 | MGC126835 | MGC126837ribosomal protein S18Affinity Capture-WesternBioGRID12145273 
 
KEGG Pathway Info
hsa04012: ErbB signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04020: Calcium signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04310: Wnt signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04720: Long-term potentiation - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04740: Olfactory transduction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04912: GnRH signaling pathway - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa04916: Melanogenesis - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05214: Glioma - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1456186251A,m8hsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
miR-185194719541A,m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-27174117471Ahsa-miR-27abrainUUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrainUUCACAGUGGCUAAGUUCUGC
miR-30-5p1701771A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-31203120381A,m8hsa-miR-31AGGCAAGAUGCUGGCAUAGCUG
miR-361164816551A,m8hsa-miR-361brainUUAUCAGAAUCUCCAGGGGUAC
miR-4948490m8hsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-505188118881A,m8hsa-miR-505GUCAACACUUGCUGGUUUCCUC
hsa-miR-505GUCAACACUUGCUGGUUUCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.