Gene Page: TFAP2D

Summary
GeneID  83741
Symbol  TFAP2D
Synonyms  TFAP2BL1
Description  transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
See related  HGNC:15581|MIM:610161|Ensembl:ENSG00000008197|HPRD:11627|
Locus tag  -
Gene type  protein-coding
Map location  6p12.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0005515protein bindingIEA-
GO:0016563transcription activator activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006350transcriptionIEA-
GO:0006355regulation of transcription, DNA-dependentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005667transcription factor complexIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-13388941Ahsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-15/16/195/424/4973440m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.