Gene Page: MAGI1

Summary
GeneID  9223
Symbol  MAGI1
Synonyms  AIP3|BAIAP1|BAP1|MAGI-1|TNRC19|WWP3
Description  membrane associated guanylate kinase, WW and PDZ domain containing 1
See related  HGNC:946|MIM:602625|Ensembl:ENSG00000151276|HPRD:04020|
Locus tag  -
Gene type  protein-coding
Map location  3p14.1
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
AssociationA combined odds ratio method (Sun et al. 2008), association studies2Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005524ATP bindingIEA-
GO:0008022protein C-terminus bindingTAS9647739 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006461protein complex assemblyNAS9647739 
GO:0007155cell adhesionTAS9647739 
GO:0007166cell surface receptor linked signal transductionTAS9647739 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneTAS9647739 
GO:0005923tight junctionIEABrain (GO term level: 10)-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACCN3ASIC3 | DRASIC | SLNAC1 | TNaC1amiloride-sensitive cation channel 3-HPRD,BioGRID15317815 
ASIC3 interacts with MAGI-1B.BIND15317815 
ACTN4ACTININ-4 | DKFZp686K23158 | FSGS | FSGS1actinin, alpha 4-HPRD,BioGRID12042308 
ATN1B37 | D12S755E | DRPLA | NODatrophin 1Atrophin-1 interacts with AIP-3.BIND9647693 
-HPRD,BioGRID9647693 
BAI1FLJ41988brain-specific angiogenesis inhibitor 1-HPRD,BioGRID9647739 
BZW1BZAP45 | KIAA0005 | Nbla10236basic leucine zipper and W2 domains 1Affinity Capture-MSBioGRID17353931 
CDH1Arc-1 | CD324 | CDHE | ECAD | LCAM | UVOcadherin 1, type 1, E-cadherin (epithelial)Affinity Capture-WesternBioGRID10772923 
CTNNB1CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923catenin (cadherin-associated protein), beta 1, 88kDaAffinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID10772923 
DLL1DELTA1 | DL1 | Deltadelta-like 1 (Drosophila)Delta1 interacts with MAGI-1.BIND15509766 
FCHSD2KIAA0769 | NWK | SH3MD3FCH and double SH3 domains 2Affinity Capture-Western
Reconstituted Complex
Two-hybrid
BioGRID14627983 
IL6RCD126 | IL-6R-1 | IL-6R-alpha | IL6RA | MGC104991interleukin 6 receptor-HPRD9169421 
LRP2DBS | gp330low density lipoprotein-related protein 2-HPRD,BioGRID11274227 
NET1ARHGEF8 | NET1Aneuroepithelial cell transforming 1-HPRD,BioGRID11350080 
RASA1CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAPRAS p21 protein activator (GTPase activating protein) 1-HPRD9169421 
SFNYWHASstratifinAffinity Capture-MSBioGRID15778465 
SYNPOKIAA1029synaptopodin-HPRD,BioGRID12042308 
TP53BP253BP2 | ASPP2 | BBP | PPP1R13A | p53BP2tumor protein p53 binding protein, 2-HPRD9169421 
WBP1MGC15305 | WBP-1WW domain binding protein 1Protein-peptideBioGRID9169421 
WBP2MGC18269 | WBP-2WW domain binding protein 2Protein-peptideBioGRID9169421 
 
KEGG Pathway Info
hsa04530: Tight junction - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
hsa05050: Dentatorubropallidoluysian atrophy (DRPLA) - Homo sapiens (human)Go to KEGGAll SZGR genes in this pathway
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-101145514621A,m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-15319291935m8hsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-1822372441A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-185328334m8hsa-miR-185brainUGGAGAGAAAGGCAGUUC
miR-1882552621A,m8hsa-miR-188CAUCCCUUGCAUGGUGGAGGGU
miR-2055765831A,m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-2316281634m8hsa-miR-23abrainAUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrainAUCACAUUGCCAGGGAUUACC
miR-24131513221A,m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-320195919651Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-323162816341Ahsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-34b130613131A,m8hsa-miR-34bUAGGCAGUGUCAUUAGCUGAUUG
miR-381158715941A,m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-4112632m8hsa-miR-411AACACGGUCCACUAACCCUCAGU
miR-496170717131Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-962382441Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.