Gene Page: SFRS11

Summary
GeneID  9295
Symbol  SFRS11
Synonyms  DKFZp686M13204|dJ677H15.2|p54
Description  splicing factor, arginine/serine-rich 11
See related  HGNC:10782|MIM:602010|Ensembl:ENSG00000116754|HPRD:03599|
Locus tag  -
Gene type  protein-coding
Map location  1p31
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.02692 
ExpressionExpressionP value: 1.382 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003676nucleic acid bindingIEA-
GO:0003723RNA bindingIEA-
GO:0005515protein bindingIPI17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000398nuclear mRNA splicing, via spliceosomeEXP12226669 
GO:0008380RNA splicingTAS1896467 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA18029348 
GO:0005634nucleusTAS1896467 
GO:0005730nucleolusIDA18029348 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PUF60FIR | FLJ31379 | RoBPI | SIAHBP1poly-U binding splicing factor 60KDaAffinity Capture-MSBioGRID17353931 
-HPRD10606266 
RNPS1E5.1 | MGC117332RNA binding protein S1, serine-rich domainRNPS1 interacts with p54.BIND14729963 
SFRS1ASF | MGC5228 | SF2 | SF2p33 | SRp30asplicing factor, arginine/serine-rich 1-HPRD,BioGRID8816452 
SFRS2PR264 | SC-35 | SC35 | SFRS2A | SRp30bsplicing factor, arginine/serine-rich 2-HPRD,BioGRID8816452 
SNRNP70RNPU1Z | RPU1 | SNRP70 | U170K | U1AP | U1RNPsmall nuclear ribonucleoprotein 70kDa (U1)-HPRD8816452 
TOP1TOPItopoisomerase (DNA) I-HPRD,BioGRID9756848 
U2AF2U2AF65U2 small nuclear RNA auxiliary factor 2-HPRD,BioGRID8816452 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-130/3015956011Ahsa-miR-130abrainCAGUGCAAUGUUAAAAGGGCAU
hsa-miR-301CAGUGCAAUAGUAUUGUCAAAGC
hsa-miR-130bbrainCAGUGCAAUGAUGAAAGGGCAU
hsa-miR-454-3pUAGUGCAAUAUUGCUUAUAGGGUUU
miR-14379861A,m8hsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-148/1523893961A,m8hsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-15/16/195/424/497245251m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-18311301136m8hsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-217100510111Ahsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-370284290m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
miR-3819779831Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-409-3p491497m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
miR-493-5p11411147m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-495471477m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.