Gene Page: SLC4A7

Summary
GeneID  9497
Symbol  SLC4A7
Synonyms  DKFZp686H168|NBC2|NBC3|SBC2|SLC4A6
Description  solute carrier family 4, sodium bicarbonate cotransporter, member 7
See related  HGNC:11033|MIM:603353|Ensembl:ENSG00000033867|HPRD:04521|
Locus tag  -
Gene type  protein-coding
Map location  3p22
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.006 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005215transporter activityIEA-
GO:0005452inorganic anion exchanger activityIEA-
GO:0005515protein bindingIPI17353931 
GO:0008509anion transmembrane transporter activityIEA-
GO:0008510sodium:bicarbonate symporter activityNAS10347222 
GO:0015293symporter activityIEA-
GO:0031402sodium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006814sodium ion transportIEA-
GO:0006820anion transportIEA-
GO:0015701bicarbonate transportNAS10347222 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005886plasma membraneIEA-
GO:0016021integral to membraneNAS10347222 
GO:0016323basolateral plasma membraneIEA-
GO:0016324apical plasma membraneIEA-
GO:0042995cell projectionIEAaxon (GO term level: 4)-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CFTRABC35 | ABCC7 | CF | CFTR/MRP | MRP7 | TNR-CFTR | dJ760C5.1cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)-HPRD,BioGRID12403779 
SLC4A4DKFZp781H1314 | HNBC1 | KNBC | NBC1 | NBC2 | SLC4A5 | hhNMC | pNBCsolute carrier family 4, sodium bicarbonate cotransporter, member 4-HPRD10600945 
YWHABGW128 | HS1 | KCIP-1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptideAffinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
let-7/98241724231Ahsa-let-7abrainUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrainUGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrainUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrainAGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrainUGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrainUGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brainUGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZUGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrainUGAGGUAGUAGUUUGUGCUGU
miR-124.1236923761A,m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/506236923751Ahsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-137401940251Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-15/16/195/424/497190819151A,m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
miR-17-5p/20/93.mr/106/519.d24792485m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
miR-18228762882m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-183119912051Ahsa-miR-183UAUGGCACUGGUAGAAUUCACUG
miR-2621832189m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
miR-30-5p259726041A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-34/449119612031A,m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
miR-363242624321Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-410376837741Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-486200820141Ahsa-miR-486UCCUGUACUGAGCUGCCCCGAG
miR-500242424311A,m8hsa-miR-500AUGCACCUGGGCAAGGAUUCUG
miR-503190919151Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.