Gene Page: USP34

Summary
GeneID  9736
Symbol  USP34
Synonyms  FLJ43910|KIAA0570|KIAA0729|MGC104459
Description  ubiquitin specific peptidase 34
See related  HGNC:20066|Ensembl:ENSG00000115464|HPRD:11665|
Locus tag  -
Gene type  protein-coding
Map location  2p15
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
ExpressionExpressionP value: 1.551 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004221ubiquitin thiolesterase activityIEA-
GO:0008233peptidase activityIEA-
GO:0008234cysteine-type peptidase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006511ubiquitin-dependent protein catabolic processIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1404394451Ahsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-218537543m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-29500506m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-3814254321A,m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-4965485541Ahsa-miR-496AUUACAUGGCCAAUCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.