Gene Page: ARHGEF11

Summary
GeneID  9826
Symbol  ARHGEF11
Synonyms  DKFZp667F1223|GTRAP48|KIAA0380|PDZ-RHOGEF
Description  Rho guanine nucleotide exchange factor (GEF) 11
See related  HGNC:14580|MIM:605708|Ensembl:ENSG00000132694|HPRD:09302|
Locus tag  -
Gene type  protein-coding
Map location  1q21
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0001664G-protein-coupled receptor bindingIDA15755723 
GO:0004871signal transducer activityIEA-
GO:0005085guanyl-nucleotide exchange factor activityIEA-
GO:0005089Rho guanyl-nucleotide exchange factor activityIEA-
GO:0005089Rho guanyl-nucleotide exchange factor activityTAS10026210 
GO:0005096GTPase activator activityIEA-
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI10026210 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000910cytokinesisNAS10026210 
GO:0001558regulation of cell growthNAS10026210 
GO:0006928cell motionNAS10026210 
GO:0006941striated muscle contractionNAS10026210 
GO:0007186G-protein coupled receptor protein signaling pathwayTAS10026210 
GO:0030010establishment of cell polarityNAS10026210 
GO:0030036actin cytoskeleton organizationNAS10026210 
GO:0035023regulation of Rho protein signal transductionIEA-
GO:0045893positive regulation of transcription, DNA-dependentIDA10026210 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIC10026210 
GO:0005622intracellularIEA-
GO:0005737cytoplasmIDA15755723 
GO:0016020membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GNA12MGC104623 | MGC99644 | NNX3 | RMP | gepguanine nucleotide binding protein (G protein) alpha 12-HPRD,BioGRID10026210 
GNA13G13 | MGC46138guanine nucleotide binding protein (G protein), alpha 13-HPRD,BioGRID10026210 
PLXNB1KIAA0407 | MGC149167 | PLEXIN-B1 | PLXN5 | SEPplexin B1-HPRD,BioGRID12183458 
PLXNB2KIAA0315 | MM1 | Nbla00445 | PLEXB2 | dJ402G11.3plexin B2Affinity Capture-Western
Two-hybrid
BioGRID12123608 |12183458 
PLXNB3FLJ76953 | PLEXB3 | PLEXR | PLXN6plexin B3-HPRD,BioGRID12183458 
RHOAARH12 | ARHA | RHO12 | RHOH12ras homolog gene family, member A-HPRD,BioGRID10526156 
SLC1A6EAAT4 | MGC33092 | MGC43671solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6-HPRD11242047 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1289951001m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-132/21210701076m8hsa-miR-212SZUAACAGUCUCCAGUCACGGCC
hsa-miR-132brainUAACAGUCUACAGCCAUGGUCG
miR-17-5p/20/93.mr/106/519.d374380m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.