Gene Page: PJA2

Summary
GeneID  9867
Symbol  PJA2
Synonyms  KIAA0438|Neurodap1|RNF131
Description  praja 2, RING-H2 motif containing
See related  HGNC:17481|Ensembl:ENSG00000198961|HPRD:11436|
Locus tag  -
Gene type  protein-coding
Map location  5q21.3
 
Gene in Data Sources
Gene set nameMethod of gene setEvidenceInfo
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
Gene Expression ?
 
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0016874ligase activityIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006511ubiquitin-dependent protein catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005737cytoplasmIEA-
GO:0005783endoplasmic reticulumIEA-
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005794Golgi apparatusIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
MAGED1DLXIN-1 | NRAGEmelanoma antigen family D, 1-HPRD,BioGRID11959851 
UBE2D2E2(17)KB2 | PUBC1 | UBC4 | UBC4/5 | UBCH5Bubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)-HPRD,BioGRID12036302 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1145514611Ahsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-20521522158m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-323138713941A,m8hsa-miR-323brainGCACAUUACACGGUCGACCUCU
miR-33239624021Ahsa-miR-33GUGCAUUGUAGUUGCAUUG
hsa-miR-33bGUGCAUUGCUGUUGCAUUGCA
miR-36365711Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-380-5p187318791Ahsa-miR-380-5pUGGUUGACCAUAGAACAUGCGC
hsa-miR-563AGGUUGACAUACGUUUCCC
miR-41075811Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-455124912561A,m8hsa-miR-455UAUGUGCCUUUGGACUACAUCG
miR-5441621691A,m8hsa-miR-544AUUCUGCAUUUUUAGCAAGU
miR-9179618021Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics Lab @ VIPBG, VCU All Rights Reserved.